Table of contents :

• induction of unresponsiveness may be ...
• ... generalized : immunosuppressive agents (~ mg/kg/day) (see also immunosuppressive monoclonal antibodies)


Indications :
• prevention of rejection after organ transplantation
• prevention of GvHD after organ transplantation
• autoimmune diseases
Side effects :
• opportunistic infections
• from environmental microorganisms
• from live vaccines
• from cancer cells in a donated organ to a transplant patient : it is rare, but the chances of it happening long after the donor was treated are not extremely unlikely.
• secondary tumors
• posttransplant lymphoproliferative disorder (PTLD)
• other drug-induced disorders
Agents :
• calcineurin / PP2B inhibitors. Calcineurin is required for NFAT nuclear translocation and transcription of IL-2. Calcineurin is naturally inhibited by calcineurin binding protein 1 (CABIN1) and carabin, which also inhibits the Ras signalling pathway through its intrinsic Ras GTPase-activating protein (GAP) activity. Expression of Carabin is upregulated on TCR signalling in a manner that is sensitive to inhibitors of calcineurin, indicating that Carabin constitutes part of a negative regulatory loop for the intracellular TCR signalling pathway. Knockdown of Carabin by short interfering RNA led to a significant enhancement of IL-2 production by antigen-specific T cells in vitro and in vivo. Thus, Carabin is a negative feedback inhibitor of the calcineurin signalling pathway that also mediates crosstalk between calcineurin and Ras^ref.

Calcineurin inhibitors are catabolyzed by CYP3A.
• cyclosporine A (CsA) (Cipol-N^®, Neoral^®, Restasis^®, Sandimmune^®), discovered by J.Borel in 1978, used clinically since 1980.
• cyclosporine OG
• nonimmunosuppressive derivative NIM811
• LX201, a 1-year cyclosporine A eluting silicone matrix implant for the prophylaxis of rejection in cornea allograft recipients
Regimen : 2.5-5.0 mg/kg/day divided into 2 doses PO. Although it works alone, cyclosporine is more effective in conjunction with glucocorticoids. Since cyclosporine blocks production of IL-2 by T cells, its combination with steroids is expected to produce a double block in the macrophage => IL-6/IL-1 => T cell => IL-2 sequence.
The superiority of C₂ (CsA concentration 2 hr post-administration) compared to C₀ (concentration immediately before administration) in Neoral therapy monitoring has recently been demonstrated in several studies of new kidney or liver transplant recipients^{ref1, ref2}
Side effects : result from inhibition of calcineurin in other organ systems => ROS production
• decreased renal blood flow => chronic tubulointerstitial nephritis, hypopotassiuria, hypouricuria => hyperuricemia, (cyclosporine-associated arteriopathy) presents a serious management problem
• secondary systemic arterial hypertension
• microangiopathic hemolysis (thrombotic thrombocytopenic purpura (TTP))
• hepatotoxicity
• hirsutism
• CNS => tremor
• gingival hyperplasia
• diabetes mellitus
• drug rash with eosinophilia and systemic symptoms (DRESS)
• macrolide / macrolactams immunosuppressants. FDA has linked them to increased risk of cancer :
• tacrolimus (FK506^®, Prograf^®, Protopic^®; Fugisawa Pharmaceutical Co. Ltd, Osaka, Japan). This agent binds to FK506-binding protein (FKBP)-12 to form a complex with calcium, calmodulin and calcineurin. The ultimate result is inhibition of T-cell activation and inhibition of various other cytokines, such as IL-2, IL-3, IL-4, IL-5, IFN-g, TNF-a, and GM-CSF. Tacrolimus is 10 times to 100 times more potent than cyclosporine, presumably because of its greater affinity for calcineurin. The adverse-effect profile of tacrolimus is similar to cyclosporine, although the renal dysfunction is more pronounced with tacrolimus. The drug was first used in liver transplantation and may substitute for cyclosporine entirely or be tried as an alternative in renal patients whose rejections are poorly controlled by cyclosporine. Tacrolimus is 10 times to 100 times more potent than cyclosporine, presumably because of its greater affinity for calcineurin

Regimen : 0.1-0.3 mg/kg/day divided into 2 doses PO
Side effects :
• renal dysfunction is more pronounced than with cyclosporine : chronic tubulointerstitial nephritis, hypopotassiuria, hypouricuria, (cyclosporine-associated arteriopathy) presents a serious management problem^ref
• hepatotoxicity
• CNS => tremor
• diabetes mellitus(more common than with CsA)
• pimecrolimus / SDZ ASM 981 (Elidel^®) is an ascomycin derivative and NSAID: it inhibits the production of inflammatory cytokines in T cells and mast cells and prevents the release of preformed inflammatory mediators from mast cells
• voclosporin / LX211 / ISA247 (Lux Biosciences, formerly Isotechnika, Inc, Canada) is a novel calcineurin inhibitor intended for the treatment of autoimmune diseases, such as psoriasis and uveitis, and prevention of organ transplant rejection. It differs from ciclosporin by a chemical modification of the functional group at the aminoacid-1 residue. This modification has improved the molecule in 2 ways. First, ISA247 binds more tightly to calcineurin than does ciclosporin, leading to a more complete inhibition of calcineurin. Second, the metabolism of ISA247 has been shifted away from aminoacid-1, which is the major site of metabolism for ciclosporin. This shift leads to a faster elimination of metabolites and a lower drug and metabolite load after the administration of ISA247 than with ciclosporin. In turn, fewer metabolites lead to improved pharmacokinetic and pharmacodynamic predictability^ref.

Immunophilins are cell proteins that bind immunosuppressive agents :
• FK506-binding protein (FKBP) family
• FKBP1A / FKBP12
• FKBP1B / FKBP12.6
• FKBP2 / FKBP13
• FKBP3 / FKBP25
• FKBP4 / FKBP52 / FKBP59
• FKBP5
• FKBP6 / FKBP36
• FKBP8 / FKBP38
• FKBP-like
• cyclosporine A immunophilins (cyclophilin (Cyp)) family
• CypA
• CypA-like 1
• CypA-like 2
• CypB : it binds to CAML, which in turn binds to TACI
• CypC
• CypD
• CypE
• CypF
• CypG
• CypH
• Cyp-like 1
• Cyp-like 2
• Cyp-like 3
• Cyp-like 4
• glucocorticoid receptor (GR) agonists

Pharmacodynamics : glucocorticoids mediate their effects via
• genomic effects (interaction with cytosolic glucocorticoid receptors and, finally, with the genome) : they are most important and can be divided into :
• transrepression (inhibition of the synthesis of regulatory proteins)
• transactivation (induction of the synthesis of regulatory proteins)
It became evident over the past few years that many adverse effects are predominantly caused by transactivation (eg, diabetes, glaucoma. For example, important enzymes of gluconeogenesis, an essential pathway in the development of diabetes, are induced by glucocorticoids^{ref1, ref2}. Transactivation is also partly involved in the mediation of other adverse reactions, such as osteoporosis, skin atrophy, growth retardation, and Cushingoid appearance^ref (Schacke H, Döcke WD, Asadullah K. Mechanisms involved in the side effects of glucocorticoids. Pharm Ther 2002; 96: 23-43). By contrast, anti-inflammatory effects are mostly mediated by transrepression (such as the inhibition of the synthesis of proinflammatory cytokines or cyclo-oxygenase 2)^{ref1, ref2} (Schacke H, Döcke WD, Asadullah K. Mechanisms involved in the side effects of glucocorticoids. Pharm Ther 2002; 96: 23-43)

• non-genomic effects (eg, interactions with cellular membranes)^ref
Glucocorticoids at pharmacological concentrations ...
• induce a shift from T_h1 to T_h2-polarized immune responses due mainly to down-regulation of the T_h1 cytokines : inhibition of STAT4 phosphorylation is seen within 2 hours, while downregulation of IL-12Rb₁ and b₂ chains occurs after 3 days of treatment. They interfere with the protective and defense mechanisms of activated macrophages, rather than resident macrophages. induce apoptosis in macrophages and monocytes, preventing the release of IL-6 and IL-1
• creates mutual antagonism with TcR stimulation at positive selection of T lymphocytes
• T lymphocytes with low affinity for MHC molecules undergo GR-dependent apoptosis
• inhibit activation-induced cell death (AICD) by preventing CD178 / Apo1L / FasL upregulation via glucocorticoid-induced leucine zipper (GILZ) and activation of glucocorticoid-induced TNFR family related (GITR), which can inhibit CD3-mediated but not Fas-mediated apoptosis. In cases where glucocorticoids are overexpressed, this balance could be shifted such that a higher level of activated T cells survive and thus a greater population of thymocytes that recognize self could survive. Indeed, in autoimmune disease models in animals and in patients with multiple sclerosis, there is a higher basal level of glucocorticoids. Hence long-term corticosteroid therapy would cause relapses.
• induce G₁ arrest and apoptosis in lymphoid cells : lymphopenia after large doses of glucocorticoids is primarily due to sequestration of recirculating blood lymphocytes to lymphoid tissue.
• impair synthesis of collagenase, elastase, and tPA.
• affect the activation, chemotaxis, adhesion, transmigration, apoptosis and phagocytosis of neutrophils
• reduce the circulating numbers of eosinophils probably through many factors including IL-5, IL-3, and GM-CSF. Glucocorticoids also sequester eosinophils in primary and secondary lymphoid tissues, induce apoptosis, and inhibit the recruitment of eosinophils to areas of inflammation
Regimen : to avoid negative feedback on endogenous glucocorticoids incretion, they are usually administered at the morning, when plasma levels are high
• daily (organ transplantation, autoimmune disease) : customarily, methylprednisolone, 0.5 to 1.0 g intravenously, is administered immediately upon diagnosis of beginning rejection and continued once daily for 3 days. When the drug is effective, the results are usually apparent within 96 h. Such "pulse" doses are not effective in chronic rejection. Most patients whose renal function is stable after 6 months or a year do not require large doses of prednisone; maintenance doses of 10 to 15 mg/d are the rule.
• 1-70 mg / die (0.5-1 mg/kg/daily) of prednisone : suspension after chronic use is done by gradually decreasing doses in 3-12 days.
• 1 g IV methylprednisolone q day times 3-5 das q 4-6 wks
• double dose
• boluses
• alternibus diebus : many patients tolerate an alternate-day course of steroids without an increased risk of rejection.
Acute use of single doses (e.g. during anaphylaxis) doesn't require further decreased doses. With the exception of dexamethasone and betamethasone, all glucocorticoids are inactivated by placental enzymes and are not teratogenic.

	rapidity of effects (directly related to hydrophilicity)	antiinflammatory potency	equivalent analgesic dose (p.o. or i.v.)	Na+-retaining potency (MR agonism)	duration of analgesic effect
cortisol / hydrocortisone (Flebocortid®)	immediate	1	20 mg	1	8-12 hours
cortisone		0.8	25 mg	0.8	8-12 hours
fludrocortisone		10	not used for glucocorticoid effects	125	12-36 hours
prednisone (Deltacortene® (5 mg), Deltacortene forte® (25 mg))		4	5 mg	0.8	12-36 hours
prednisolone		4	5 mg	0.8	12-36 hours
6a-methylprednisolone (Depo-Medrol®, Medrol®, Urbason®, Solu-Medrol®)		5	4 mg	0.5	12-36 hours
deflazacort			6 mg		12-36 hours
triamcinolone		5	4 mg	0	12-36 hours
betamethasone (p.o., i.v. Bentelan®)		25	0.75 mg	0	36-72 hours
dexamethasone (i.v. Decadron®, Soldesam®)		25	0.75 mg	0	36-72 hours

• selective glucocorticoid receptor agonists (SEGRA or dissociating glucocorticoids) have a non-steroidal structure :
• ZK 216348^ref
• nitrosteroids / nitrosoglucocorticoids : an aliphatic or aromatic molecule which links a conventional glucocorticoid derivative with nitric oxide^{ref1, ref2, ref3, ref4, ref5}
• NCX-1015 (NO-prednisolone)
• NCX-1004 (NO-hydrocortisone)
Approaches to optimise therapy with conventional glucocorticoids :
• long-circulating liposomal glucocorticoids^{ref1, ref2, ref3, ref4}
• timed-release tablets
Side effects : iatrogenic primary Cushing's disease, growth retardation, toxic cataract. The side effects of the glucocorticoids, particularly impairment of wound healing and predisposition to infection, make it desirable to taper the dose as rapidly as possible in the immediate postoperative period

• IMP dehydrogenase (IMPDH) 2 uncompetitive and reversible inhibitors. This inhibition blocks new purine synthesis by preventing the synthesis of guanosine nucleotides necessary for DNA and RNA synthesis. MMF affects lymphocytes because they are dependent on this purine synthesis pathway and do not have alternate salvage pathway capabilities^ref [12]. They also inhibit the maturation/differentiation of DCs, their expression of costimulatory molecules and their production of IL-12, but enhance their production of IL-10.
• mycophenolate mofetil (MMF, CellCept^®; Roche USA Pharmaceuticals, Nutley, NJ, USA)
Regimen : 1-1.5 g IV or PO BID
Side effects : mild degree of gastrointestinal toxicity but produces minimal bone marrow suppression. Its advantage is its increased potency in preventing or reversing rejection. Patients with hyperuricemia can be given allopurinol without adjustment of the mycophenylate dose.
• EDG6 / S1P₄ agonists : fingolimod / FTY720 / 2.amino-2-(2-[4-octylphenyl]ethyl)-1,3-propanediol hydrochloride (Gilenya^®; source : Novartis) - a synthetic derivative of the antifungal agent myriocin^ref - causes immunosuppression in animal models of transplantation and autoimmunity^ref. Initial observations showed that FTY720 causes apoptosis^ref, but subsequent studies have reaised doubt that its pro-apoptotic activity is responsible for immunosuppression^ref. The drug markedly decreases lymphocyte recirculation to blood and peripheral tissues, including inflammatory lesions and graft sites (i.e. decreases the number of circulating lymphocytes and increases lymphocyte numbers in the LNs^ref). FTY720 treatment makes T-cell homing to LNs less dependent on CCR7. Interestingly, FTY720 also prevents lymphocyte egress from the thymus^ref and from the LNs into efferent lymphatics^ref. Recent studies have shown that FTY720 is phosphorylated by sphingosine kinase to an active metabolite that resembles sphingosine-1-phosphate (S1P) and binds to 4 of the 5 known S1P receptors, EDG1 / S1P₁, EDG3 / S1P₃, EDG6 / S1P₄, and EDG8 / S1P₅^{ref1, ref2}. S1P₁ and S1P₄ are found on lymphocytes and can modulate lymphocyte responsiveness to chemokines. Recent findings indicate that FTY720 enhances the efflux of cysteine leukotrienes from T cells, and this effect was required for its activity in T-cell homing^ref. S1P receptors are also expressed by the endothelium. So, some of the effects of FTY720 could be caused by action on vascular or lymphatic endothelial cells. Posology : 1.25 mg daily i.v.
• CB₁ agonistsreduce capacity to generate T_h1 lymphocytes and down-regulate T_h1-lymphocyte effector functions
• (-)-sanglifehrin A (SFA) (initially discovered in a Streptomyces sp. A92-308110 soil sample from Malawi, then synthesized in a highly convergent and stereocontrolled manner) is a representative of a class of macrolides produced by actinomycetes that binds with high affinity with the CsA binding side of CypA and CypD and inhibits its peptidyl-prolyl isomerase activity but has no effect on the phosphatase activity of calcineurin and its effects are independent of binding of cyclophilin. SFA inhibits alloantigen-stimulated T cell proliferation but acts at a later stage than CsA and FK506 and does not affect IL-2 transcription or secretion. However, it blocks IL-2-dependent proliferation and cytokine production of T cells, in this respect resembling rapamycin, and blocks bioactive IL-12 production by human dendritic cells. SFA inhibits the proliferation of mitogen-activated B cells, but, unlike rapamycin, it has no effect on CD154/IL-4-induced Ab synthesis. It does not affect de novo purine and pyrimidine biosynthesis.
• JAK3 inhibitors^ref
• VDR agonists inhibit dendritic cell maturation
• NFkB inhibitors
• cetylmyristoleate (sources : beef tallow, butterfat, chicken fat, and sheep tallow; synthetically produced cetylmyristoleate contains 50% of trans type cetylmyristoleate, which causes physical damage by disrupting cellular membranes. Even in some so-called "natural" products there remains a trace of toxic residue left from harsh processing; very low oral bioavailability of the liquid wax, higher for waxy solid cerasomal-cis-9-cetylmyristoleate (CMO^®, CMO II^®,  Duoflex CMO^+® has added 2 lipases to each capsule to increase absorption; Imunall^®) which has a crystalline structure that shatters in the alkaline environment of the small intestine) has unproven efficacy in treatment of arthritides
• Syk inhibitors
• mast cell stabilizers
• cromones
• disodium cromoglycate (DSCG) / cromolyn sodium (Crolom^®, Intal^®), a khellin derivative
• nedocromyl sodium (Tilade^®; Zarent^® in combination with salbutamol)
• iodoxamide tromethamine (Alomide^®)
• pemirolast (Alamast^®, Alegysal^®)
• MN-001
• aspecific antiproliferative / antiblastic / antimetabolic / antimitotic / cytotoxic agents :
• photodynamic therapy (PDT)
• mTOR inhibitors (also antiangiogenetics used as anticancer drugs) : mTOR is the kinase subunit of two mTOR-containing complexes, mTOR complex (mTORC) 1 and 2.
  
• azathioprine (AZA) (Imuran^®) : following exposure to nucleophiles, such as glutathione, it is cleaved to 6-mercaptopurine (6-MP), which, in turn, is converted to additional metabolites (6-thioguanine (6-TG)) that inhibit de novo purine synthesis.


6-MP is catabolized by thiopurine S-methyltransferase (TPMT)
Regimen : 1.5-3 mg/kg/day p.o.
• azathioprine sodium : the sodium salt of azathioprine, used to prevent transplant rejection in organ transplantation; administered intravenously.
Indications :
• prevention of transplant rejection in organ transplantation; also used (investigationally) to prevent transplant rejection in cardiac, hepatic, and pancreatic transplantation
• treatment of a number of autoimmune disorders, such as systemic lupus erythematosus, autoimmune hemolytic anemia, and severe, progressive rheumatoid arthritis unresponsive to other agents
Side effects : because azathioprine is rapidly metabolized by the liver, its dosage need not be varied directly in relation to renal function, even though renal failure results in retention of the metabolites of azathioprine. Reduction in dosage is required because of leukopenia (27%) and occasionally thrombocytopenia (5%)^ref. It is recognized that persons with low levels of activity of the enzyme thiopurine methyltransferase are at increased risk of bone marrow toxic effects, and consequently many physicians perform an analysis of TPMT activity before the initiation of azathioprine therapy^ref. Excessive amounts of azathioprine may also cause jaundice, anemia, and alopecia. If it is essential to administer allopurinol concurrently, the azathioprine dose must be reduced, since inhibition of xanthine oxidase delays degradation. This combination is best avoided.
• methotrexate (MTX). It is an antimetabolite that binds to dihydrofolic acid reductase, thereby preventing the reduction of folic acid to tetrahydrofolate. It interferes with DNA synthesis, repair and cellular replication and, thus, actively proliferating tissues are in general more sensitive to this effect. The mechanism of methotrexate's immunosuppressive effect was recently found to be related to its ability to inhibit the first committed step of purine biosynthesis in stimulated human T lymphocytes^ref [10]
• cyclophosphamide (CP)

Regimen : pulsed 1 g/m² IV over 1.5 hr; corticosteroids, metoclopramide (0.5-1.0 mg/kg) and diphenhydramine HCl are given before the cyclophosphamide to control nausea.
• stilbenes
• hydroxystilbenes (consisting of 2 benzene rings connected through olefin)
• trans-3,4',5-trihydroxystilbene / resveratrol inhibits the expression of COX-2 and lipid peroxidation
• trans-3,4,3',5'-tetrahydroxystilbene / piceatannol inhibits PKA (K_i = 3 mM), PKC (K_i = 8 mM), MLCK (K_i = 12 mM) and p56^Lck and Syk (K_i = 15 mM) and activates caspase-3.
• rhaponticin
• chlorambucil. Regimen : oral 2-3 mg/kg day; 0.1 mg/kg/day
• dihydroorotate dehydrogenase (DHODH) inhibitors inhibit T_h1 cell activation and promote T_h2 cell differentiation.
See under antineoplastic agents for side effects.
• TLR antagonists
• TLR4 antagonists : for the treatment of sepsis
• E5531^ref, based on the proposed structure of nontoxic Rhodobacter capsulatus lipid A^{ref1, ref2}
• E5564 / eritoran^ref

• .. selective : tolerogens (see also induction of peripheral tolerance in immunotherapy). They are used in ...
• ... the same circumstances of immunosuppressors, without their side effects
• ... prevention of immune responses against viral vectors used in gene therapy
• soluble HLA and peptides corresponding to linear sequences of HLA molecules
• abetimus sodium / LJP 394 (Rentol^®, Riquent^®; source : La Jolla Pharmaceutical Company) is a synthetic toleragen molecule consisting of 4 double-stranded oligodeoxyribonucleotides attached to nonimmunogenic polyethylene glycol, a proprietary carrier platform. Abetimus is an immunomodulating agent that induces tolerance in B cells directed against double-stranded DNA (dsDNA). It does this by cross-linking surface antibodies. These antibodies are thought to be responsible for lupus nephritis, a chronic kidney disease that develops in patients with systemic lupus erythematosus
• T_Reg lymphocytes inducers :
• 15-deoxyspergualine (DSG) is a derivative of spergualine : it decreases Ab production, inhibits IL-6 and TNF-a production, inhibits B cell development, inhibits the growth of naive CD4 T cells after activation and production of IFN-g by T_h1 lymphocytes.
• LF08-0299
• LF15-0195
• 3,4-dimethoxycinnamonyl-anthranilic acid (tranilast) is an orally available anti-allergic drug with structural and functional homologies to immunosuppressive catabolites of the essential amino acid tryptophan and broad anti-inflammatory properties.
• polyunsaturated fatty acids (PUFAs) : dietary supplementation, especially those of the n-3 class, has immunosuppressive effects on both innate and adaptive immunity through various mechanisms. The immunosuppressive effects of PUFAs begin with membrane incorporation and modulation of lipid-protein lateral organization. This in turn inhibits downstream signaling mediated by T cell receptors and suppresses T cell activation and proliferation. Next, we review evidence for PUFA-mediated alteration of major histocompatibility complex class I and II surface expression and antigen presentation. We propose that PUFAs influence the expression of major histocompatibility complex by altering its conformation, orientation, lateral organization, and trafficking, with consequences for recognition by effector T cells. PUFA acyl chains are unique in modifying membrane lateral organization and protein function. An important concept to emerge from these studies is that PUFA acyl chains and cholesterol molecules are sterically incompatible. By applying this concept to the T cell activation and signaling model, mechanisms emerge by which PUFAs can modulate membrane lipid-protein lateral organization. Membrane modification of both effectors and targets is an important, often overlooked, mechanism of immunomodulation by PUFAs^ref.
• HMG-CoA reductase inhibitors^ref, collectively known as statins, because of their broad and extensive clinically beneficial effects and their extremely low incidence of side effects, statins might even be seen as the new aspirin^ref. The concentrations of statins in tissues during therapy is unknown but is probably <10 µmol/L^ref. Statins are used clinically to :
• reduce cholesterolemia^{ref1, ref2}. Clinical benefits (reduction in cardiovascular events and mortality) directly attributed to the cholesterol lowering effect of statins have been extensively demonstrated in patients with atherosclerosis and cardiovascular diseases with or without coronary artery disease symptoms^{ref1, ref2, ref3, ref4, ref5, ref6, ref7}. At present, 5 statins are available in the US and most other Western countries: atorvastatin, fluvastatin, lovastatin, pravastatin, and simvastatin. It is estimated that about 25 million people worldwide are currently being treated with a statin. The number of prescriptions for statins issued in developed countries in 2000 was almost 30-fold greater than the number written in 1991. WHO statistics indicate that there are about 200 million people worldwide with coronary artery disease, stroke, other occlusive vascular diseases, or diabetes mellitus. Consequently, a proposal has been made that tens of millions of people at increased risk of heart attacks and strokes should begin statin treatment before onset of disease^ref.
• reduced risk of cancer^{ref1, ref2, ref3} :
• colon cancer (Poynter et al. reported a 47%^ref reduction in the risk of colorectal cancer among long-term statin users (i.e., > 5 years), as compared with short-term users or nonstatin users. In contrast, a randomized trial^ref and meta-analyses^{ref1, ref2, ref3} have found either a slight increase in cancer among statin users or no relation between statins and cancers. Although trials are often limited to comparatively young, low-risk patients and have short follow-up, this difference may result from methodologic limitations in the observational study by Poynter et al.^ref ). 3-hydroxy-3-methylglutaryl coenzyme A reductase activity is upregulated in left-sided human colon cancer^ref
• prostate cancer^{ref1, ref2, ref3, ref4, ref5}
• breast cancer^{ref1, ref2, ref3, ref4, ref5}
• by altering cell membranes, which are rich in cholesterol
• by reducing inflammation, which appears to play a role in cancer
• by stalling tumor growth
• cholesterol metabolism is dysregulated in many malignancies, including myeloid leukemias. Freshly isolated AML and CML cells show more LDL processing than normal blood cells^{ref1, ref2}, and cholesterol levels in leukemia cells often do not exhibit feedback repression in high-sterol media^ref. Rapidly proliferating tumor cells presumably require cholesterol for new membrane synthesis. However, high cellular cholesterol may also improve leukemia cell survival and impart relative resistance to therapy. Compared with their parental cell lines, drug-resistant myeloid leukemia cell lines show higher HMG-CoA reductase levels^ref, and drug-resistant lymphoid leukemia cell lines have increased cholesterol and phospholipid levels^ref, suggesting that acute cholesterol responses may contribute to drug resistance. Consistent with a critical role(s) for the mevalonate pathway in tumor cell growth and survival, and with the rate-limiting role of HMG-CoA reductase in this synthetic pathway, statins have in vivo or in vitro activity against human head and neck, pancreatic, and CNS tumors and against human myeloid leukemia cells in xenograft models^{ref1, ref2, ref3, ref4, ref5}. Acute renal injuries caused by ischemia, oxidant damage, and ureteral obstruction increase renal cortical cholesterol content^ref. Cholesterol levels are similarly increased in cultured human HK-2 proximal renal tubule cells subjected to iron-mediated oxidant stress^ref. In these kidney cell models, increased cellular cholesterol makes cells highly resistant to subsequent damage, producing a state known as "acquired cytoresistance." Reducing cellular cholesterol levels pharmacologically blocks acquisition of cytoresistance and can generate profound mitochondrial dysfunction and death in kidney cells, further demonstrating the critical role of cholesterol in renal cell homeostasis^ref. Although a majority of adult patients with AML initially achieve complete remission with conventional chemotherapy, most eventually relapse and succumb to drug-resistant disease. Given this prevalence of drug-resistant AMLs, a number of workers have examined the potential antineoplastic effects of the cholesterol-lowering agents commonly known as "statins," either alone or as chemotherapy sensitizers. 2 groups have shown that lovastatin^ref and simvastatin^ref can sensitize AML cell lines to cytarabine. A phase 1 clinical study showed that serum lovastatin concentrations of up to 3.9 µM could be achieved without significant tissue toxicity^ref. Similar doses of lovastatin is toxic to AML cell lines and to primary AML cell samples but not to lymphocytic leukemias^ref. A subset of primary AML cell samples, but not normal myeloid cells, can be sensitized to cytarabine and/or daunorubicin by mevastatin^ref. Plasma membrane localization is essential to the function of many proteins that impact cellular proliferation and/or survival. Because the membrane localization of many of these signaling proteins requires mevalonate-derived farnesyl or geranylgeranyl isoprenoid modifications, the antitumor effects of statins have been assumed to be primarily due to their blockade of isoprenylation. For example, Ras proteins are activated by mutation and/or overexpression in a large fraction of human tumors, including myeloid leukemias, thereby contributing to reduced apoptosis, increased cell proliferation, and poor clinical outcomes^{ref1, ref2}. Isoprenylation of Ras and other similarly modified membrane proteins is specifically mediated by farnesyl-protein and geranylgeranyl-protein transferases, and FTIs can, like statins, induce tumor regression in mice carrying mammary or lymphoid tumors overexpressing H- or N-Ras^{ref1, ref2, ref3}. However, statin toxicity in primary AMLs is variable and not consistently higher in samples with Ras overexpression or with Ras activated by "hotspot" mutations^ref. Others have argued that non-Ras geranylgeranylated proteins are important statin effectors^ref. However, dependence on geranylgeranylation as well as farnesylation can be dissociated from statin sensitivity in AMLs^ref. In addition, statin concentrations necessary to inhibit specific protein isoprenylation are 100- to 500-fold higher than those required to inhibit cholesterol synthesis in the same cells^ref and are higher than the concentrations that are toxic to AML cells^ref. The squalene synthase inhibitor zaragozic acid A (ZGA), which disrupts cholesterol but not farnesyl pyrophosphate and geranylgeranyl pyrophosphate synthesis, produced cell death only in the cell lines (ie, NB4 and HL60) that mounted cholesterol increments in response to radiotherapeutic or chemotherapeutic insults and that exhibited sensitivity to mevastatin. Cotreatment of NB4 cells with ZGA and either cytarabine or radiation resulted in a marked attenuation of the cholesterol increment that would otherwise have occurred in these cells after exposure to cytarabine or radiation alone. At the same time, the addition of ZGA to cytarabine or radiation induced at least an additive toxicity in NB4 cells. This association of increased toxicity with the attenuation of cholesterol increments provides further credence for the concept of adaptive cholesterol responses as a cytoprotective mechanism in particular AMLs. One of the arguments that has been raised in the literature against a role for cholesterol modulation in the antineoplastic effects of statins has been the inability of exogenous squalene and free cholesterol to reduce lovastatin toxicity in NB4 cells^ref. However, cells do not always efficiently incorporate free sterols, as was shown for K562 cells exposed to exogenous squalene and lanosterol^ref. On the other hand, cells can efficiently obtain cholesterol from the ambient environment by receptor-mediated import of LDL^ref. Treating NB4 cells with ZGA in a serum-depleted (and hence cholesterol-depleted) medium resulted in > 70% toxicity within 24 hours, while the addition of LDL cholesterol (> 95% purity) to these cultures reversed the toxicity of ZGA, further supporting the vital cytoprotective role of cellular cholesterol in certain AMLs. These findings do not exclude the possibility that reduced isoprenylation may contribute to statin toxicity in particular AMLs but do highlight the possible importance of direct cholesterol modulation in new antileukemia therapies. Nonstatin drugs that reduce protective cellular cholesterol may be more desirable for eradicating cholesterol-dependent leukemias for several reasons. Some AMLs are apparently able to further up-regulate LDLR activity after treatment with statins^ref, which could limit the ability of statins to decrease protective cellular cholesterol. In addition, statins apparently block the production of a mevalonate-derived Ras inhibitor that accumulates when the mevalonate pathway is instead blocked at a downstream step by a diphosphomevalonate decarboxylase inhibitor^ref. Therefore, statin treatments could potentially favor the growth of tumor cells that are regulated by this inhibitor, whereas inhibition of cholesterol synthesis distal to diphosphomevalonate decarboxylase activity would not have this effect. Consistent with this idea, lovastatin can increase proliferation in a large number of primary leukemia cell samples^ref. Squalene synthase inhibitors that block cholesterol biosynthesis at the final committed step of the mevalonate pathway are being tested for hypercholesterolemia indications^{ref1, ref2}, and squalene synthase inhibitors and other direct cholesterol-modulating agents should be rigorously tested as chemotherapy sensitizers in AML^ref. The levels of mRNAs encoding HMG-CoA and LDLR are both increased by daunorubicin (DNR) or cytarabine (ARA-C) treatments in almost 75% of cultured AML samples. However, < 33% of AML samples significantly increased LDL accumulation during drug treatments, suggesting that de novo synthesis is the primary mechanism by which most AML cells increase cholesterol levels during drug exposures. LDL increments are not correlated with cholesterol increments in ARA-C–treated AML samples. However, LDL and cholesterol increments correlate in DNR-treated AML samples where they are measured, suggesting that a subset of AMLs may rely on increased LDL accumulation during treatment with particular drugs^ref.
• reduced arterial blood pressure : rosuvastatin reduced arterial pressure in genetic hypertension and improved systemic and regional hemodynamics in SHR and WHY hypertensive rat models independently of cholesterol levels^ref
• angiographic regression studies showing insignificant changes in the degree of coronary stenosis despite a large reduction in cardiac events
• reduced risk of ischemic stroke despite the fact that LDL cholesterol is not directly associated with the risk of stroke. Withdrawal of statin treatment abrogates stroke protection in mice^ref; protect cortical neurons from excitotoxicity^{ref1, ref2, ref3}. 36% reduction in heart attacks and a 27% reduction in strokes : overall, the risk of death from strokes and heart attacks was reduced by 24%^ref
• immunosuppression => antiatherosclerotic effects that are not related to lipid lowering & treatment of autoimmune diseases^ref :


• cholesterol-dependent :
• beneficial effects (on the incidence of cardiac rejection, coronary vasculopathy, and survival) of statins in cardiac transplantation seen in 2 clinical trials was generally thought to result from favorable consequences of stringent and adequate lowering of cholesterol levels^{ref1, ref2, ref3}. Anyway it is tempting to argue that the clinical benefit observed with statins in cardiac transplantation is not the result of the lowering of cholesterol levels, as was suggested, but rather the result of their demonstrated role as inhibitors of expression of CIITA. Indeed, the disruption of the CIITA gene in mice has a very strong, favorable effect on the outcome of cardiac transplantation^ref, confirming that inhibiting CIITA, and thus MHC class II expression, is beneficial in organ transplantation.
• lovastatin, simvastatin, and zaragozic acid, a squalene synthase inhibitor, blocked FcR–mediated phagocytosis by cultured human monocytes and mouse peritoneal macrophages. The inhibitory effect of lovastatin on FcR–mediated phagocytosis was prevented completely by addition of L-mevalonate, farnesyl pyrophosphate, LDL, or cholesterol to the culture medium. The inhibitory effect of zaragozic acid was reversed by addition of LDL, but not by the addition of geranylgeranyl pyrophosphate, to the medium. In addition, the effect of lovastatin on phagocytosis is a function of cell activation because treatment of cells with TNF-a or LPS prevented inhibition of phagocytosis by lovastatin. The inhibition of Fc receptor–mediated phagocytosis of lovastatin is related to its effect on cholesterol biosynthesis rather than its effect on the formation of isoprenoids^ref.
• cholesterol-independent : cell culture experiments do not reflect the complex interactions between the arterial wall and circulating leukocytes, platelets, and elements of the plasmatic coagulation system, nor can they mimic the influence of multiple organ systems that govern lipid metabolism, immune responses, or regulation of blood pressure. The main difficulty in the interpretation of clinical trials is the powerful cholesterol-lowering effect of statins, because genuine pleiotropic effects and cholesterol-dependent ones frequently affect the same pathogenic mechanisms^ref. Experimental models in which genetic, dietary, and other variables can be tightly controlled provide the only ethically acceptable way to determine the impact of selective pleiotropic effects, even though few of these models are truly representative of human pathology. The limitations imposed by imperfect animal models are even greater when it comes to assessing pleiotropic effects of statins on plaque vulnerability, plaque rupture, and atherothrombotic events. In humans, however, pleiotropic effects of statins have never been unequivocally demonstrated because prolonged statin treatment always results in reduced LDL cholesterol levels. Similar reductions in LDL cholesterol with simvastatin and ezetimibe, a novel cholesterol absorption inhibitor, result in different effects on endothelial function. 4 weeks of simvastatin treatment improves endothelial function independently of LDL cholesterol lowering, at least in part by reducing oxidant stress. Simvastatin may thereby exert important pleiotropic effects in humans^ref.
• mevalonate-dependent : because mevalonate, the product of the enzyme reaction, is the precursor not only of cholesterol but also of many nonsteroidal isoprenoid compounds, inhibition of HMG-CoA reductase may produce pleiotropic effects unlinked to cholesterol-lowering properties^{ref1, ref2, ref3, ref4, ref5}: the mevalonate pathway yields a series of isoprenoids that are vital for diverse cellular functions^ref. These isoprenoids include:
• isopentenyl adenosine, present in some types of tRNA
• dolichols, required for glycoprotein synthesis
• polyisoprenoid side chains of ubiquinone and heme A, involved in electron transport
• 24(S),25-epoxycholesterol, an agonist for LXR, the transcription factor for ABCA1 and ABCG1; so statins may downregulate cholesterol efflux from nonloaded human macrophages^ref
• farnesyl pyrophosphate or geranylgeranyl pyrophosphate (GGPP)^{ref1, ref2} chains of prenylated proteins, a prerequisite for membrane association, which is required for their function. Members of this family are involved in a number of cellular processes, including cell signaling, cell differentiation and proliferation, myelination, cytoskeleton dynamics, and endocytotic/exocytotic transport^ref. Whereas geranylgeranylation is required for activation of most of these small GTP-binding proteins (e.g. Rho, Rac, Rab, Rap), only few are farnesylated (e.g. Ras)^ref.
• inhibition of the small signaling G proteins pathways :
• Ras pathway, which normally contributes to NAD(P)H-oxidase activation and superoxide production
• Rho pathway^ref =>
• => de novo transcription of Lung-Kruppel–like factor (LKLF/KLF2) transcription factor^ref (reversed by addition of mevalonate and its downstream metabolite geranygeranyl pyrophosphate. Furthermore, inhibition of protein geranylgeranylation with GGTI-298 significantly induced KLF2 levels, whereas inhibition of farnesylation did not) => upregulation of thrombomodulin^{ref1, ref2} and upregulation of stability of eNOS mRNA (t_1/2, 43 versus 35 hours) but not transcription => increased expression by 3.8-fold, completely preventing its downregulation by ox-LDL in vitro (although L-mevalonate alone did not affect ecNOS expression, cotreatment with L-mevalonate completely reversed eNOS upregulation by simvastatin^ref) => increased endothelial nitric oxide (eNO) bioavailability (severely reduced after AMI and in CHF; eNO bioavailability is also increased by HDL, which activates both ERK1/2 and Akt, resulting in enhanced eNOS protein stability and subsequent accumulation of eNOS protein^ref: simvastatin also activates the protein kinase Akt, producing a very rapid improvement in endothelial function that is independent of changes in eNOS mRNA levels. Simvastatin treatment can attenuate endothelial cell apoptosis and augment angiogenesis in the ischemic rabbit hind limb model system^ref) =>
• => S-nitrosylation of N-ethylmaleimide sensitive factor (NSF), a critical regulator of exocytosis^ref =>
• => decreased thrombin-stimulated Weibel-Palade body exocytosis by 89% => reduced thrombosis and vascular inflammation^ref
• => inhibit platelet ADP and ATP release and the consecutive augmentation of neutrophil oxygen-free radical release^ref
• => improvement of endothelial progenitor cell mobilization, myocardial neovascularization, LV dysfunction, interstitial fibrosis, and survival after AMI^ref
Statins elevate GTP cyclohydrolase I (GTPCH) mRNA, the rate-limiting enzyme in the first step of de novo tetrahydrobiopterin (BH₄) synthesis, thereby increasing BH₄ levels in vascular endothelial cells. In addition to augmenting eNOS expression, statins potentiate GTPCH gene expression and BH₄ synthesis, thereby increasing NO production and preventing relative shortages of BH₄^ref.
Nitrotyrosine levels were significantly higher among patients with CAD (median 9.1 µmol/mol tyrosine vs 5.2 µmol/mol) : statin therapy reduced nitrotyrosine levels significantly (25%) with a magnitude similar to reductions in total cholesterol levels (25%) and LDL particle number (29%) yet were independent of alterations in lipoproteins and inflammatory markers like CRP^ref.
• => increased PPAR-g activity => enhanced LXR activation => increased ABCA1 and ABCG1 expression => cholesterol efflux^ref
• GGPP was recently demonstrated to inhibit ABCA1 and ABCG1 expression directly, through antagonism of LXR and indirectly through enhanced RhoA geranylgeranylation
Sudden discontinuation of statin therapy may have negative effects. Withdrawal of statin treatment leads to an overshoot activation of Rho and Rac with dramatic effects on NO bioavailability, NAD(P)H-oxidase activity, and superoxide production^ref. Results from the Platelet Receptor Inhibition in ischemic Syndrome Management (PRISM) study clearly demonstrated that withdrawal of statin therapy very significantly increases event rates in patients with acute coronary syndromes (ACS). Interestingly, the increased event rate occurred during the first week after the onset of symptoms and was independent of cholesterol levels^ref. Anyway short-term discontinuation of statin therapy in stable cardiac patients apparently does not lead to a clinically important increased risk of ACSs^ref.
• statins inhibit the transcription of MHC class II transactivator (CIITA), a transcription factor essential for the expression of MHC II genes^{ref1, ref2}. MHC-II molecules, expressed on the surface of specialized cells, are directly involved in the control of the immune response and thus determine rejection after organ transplantation. Whereas a limited number of specialized cell types express MHC-II constitutively, numerous other cells become MHC-II⁺ on induction by the inflammatory mediator IFN-g. This complex regulation is under the control of the transactivator CIITA, the expression of which is tightly regulated by several alternative promoters, operating under distinct physiological conditions^{ref1, ref2, ref3}. CIITA promoter IV is specifically responsible for the IFN-g inducible expression of CIITA, and thus of MHC-II^ref. Statins may regulate IFN-g–induced MHC-II expression on APCs and in this way reduce T-lymphocyte activation :
• statins effectively repress the induction of MHC-II expression by IFN-g in a dose-dependent manner^ref.
• in the presence of L-mevalonate, the effect of statins on MHC-II expression is abolished, indicating that it is, in fact, as HMG-CoA reductase inhibitors that statins mediate repression of MHC-II
• repression of MHC-II expression by statins is highly specific for the inducible form of MHC-II expression and does not affect constitutive expression of MHC-II in highly specialized APCs, such as DCs and B lymphocytes
• this effect of statins is specific for MHC-II and does not affect MHC class I expression
• pretreatment of ECs with statins reduces subsequent T-lymphocyte proliferation (mixed lymphocyte reactions), as measured by [³H]-thymidine incorporation and IL-2 release^ref
• in statin-treated samples, repression of induction of MHC-II by IFN-g is paralleled by a reduced induction of CIITA mRNA by IFN-g. Interestingly, the degrees of repression of CIITA mRNA induction observed with the different statins are reflected in the levels of repression of MHC-II expression observed with the same drugs. Constitutive expression of MHC-II, known to be mediated by CIITA promoters I and III, is not affected by statins. The specificity of statins for repressing inducible and not constitutive MHC-II expression suggests an effect on CIITA promoter IV. Indeed, induction of expression of the first exon specifically controlled by CIITA promoter IV is affected by statins
• the statin effect is transcriptional, as demonstrated by actinomycin D experiments used to block de novo RNA synthesis and explore mRNA half-life. That this effect is direct and does not require de novo protein synthesis may be seen by a lack of effect in experiments using cycloheximide.
All these effects of statins on MHC-II induction have been observed with the statins currently used in clinical medicine^{ref1, ref2}. Other investigators have confirmed these results^ref. Future studies will tell us whether there is a link between mevalonate blockade due to statins and either the availability or the cooperative binding of the 3 well-defined transcription factors, Stat1, USF-1, and IRF-1, which are required for the activity of CIITA promoter IV^ref. Atorvastatin treatment led to a significant down-regulation of HLA-DR and the CD38 activation marker on peripheral T cells, whereas simvastatin up-regulated both of these molecules. In contrast, superantigen-mediated T cell activation was inhibited by simvastatin and enhanced by atorvastatin. No significant effect of statin treatment on inflammatory serum markers was detected. Thus, immunomodulatory effects of statins on human T cells are first demonstrated in vivo and are differentially induced by 2 different statins: atorvastatin led to a MHC II down-regulation and may therefore be investigated for treatment of chronic transplant rejection; simvastatin inhibited superantigen-mediated T cell activation, which might explain reduced mortality of simvastatin-treated patients with staphylococcal bacteremia^ref.
• inhibition of VCAM-1 expression and subsequent adhesion of THP-1 monocytes to the cultured endothelial cells^ref
• inhibition of expression of chemokines : hepatic synthesis of both sterol and nonsterol derivatives was inhibited in mice by administered statins, whereas squalestatin inhibited only sterol derivatives. Using a short-term treatment schedule, statins reduced the hepatic activity of HMG-CoA reductase without affecting blood cholesterol. This treatment inhibited LPS- and carrageenan-induced subcutaneous dorsal air pouch leukocyte recruitment and the exudate production of IL-6, CCL2 / MCP-1, and CCL5 / RANTES. Coadministration of mevalonate reversed the effect of statin on leukocyte recruitment. The inhibition of sterol synthesis by squalestatin did not have any anti-inflammatory effect, indicating that the biosynthesis of nonsterol compounds arising from mevalonate is crucial for the in vivo regulation of cytokine and chemokine production by statins. Their inhibition by statins may account for the reported anti-inflammatory effects of these drugs and may provide a biochemical basis for the recently reported effects of statins in the prevention of cardiovascular disease and mortality^ref
• reduced expression of MMP-9 in the vessel wall. In addition, rosuvastatin inhibited vascular expression of p22^phox and superoxide production, as well as diminishing plasma 8-isoprostanes concentrations^ref
• pretreatment with simvastatin (50 or 100 µg/kg) 18 hours before activation of microcirculation induced by bolus administration of 40 µg/kg Staphylococcus aureus a-toxin significantly inhibited exotoxin-induced leukocyte rolling from 71±10 to 14±4.7 cells/min (P<0.01) and adherence from 14±3.5 to 0.4±0.2 cells (P<0.01). In addition, simvastatin pretreatment significantly inhibited transmigration of leukocytes from 10.5±1.2 to 4.2±0.9 (P<0.05) cells, and decreases by 50% endothelial cell surface expression of adhesion molecule P-selectin. Furthermore, simvastatin treatment resulted in enhanced expression of eNOS in the intestinal microcirculation^ref.
• dose-dependent downregulation of TLR4 with subsequent reduction in IRAK activity and cytokine and B7-1 expression. These effects were mediated via inhibition of protein geranylgeranylation and farnesylation. Effects of statins were reversed by mevalonate. Whereas wortmannin and LY294002 inhibited the statin effect, incubation with a specific RhoA kinase inhibitor had no effect^ref.
• mevastatin-treated monocytes were particularly susceptible to apoptosis, which occurred at doses >1 microM and was already maximal at 5 microM. However, even at the highest mevastatin dose used (10 mM), apoptosis occurred only after 24 h of culture, possibly reflecting a requirement for cell commitment to differentiation. After 72 h of treatment the vast majority (>50%) of monocytes were undergoing apoptosis. Stimulation with LPS revealed that mevastatin-treated monocytes retained the high IL-1b output characteristic of undifferentiated cells; conversely, IL-1Ra release was inhibited. Concurrent treatment with mevalonolactone prevented the induction of apoptosis and suppressed both IL-1b and IL-1Ra release in response to LPS, suggesting a rate-limiting role for HMG-CoA reductase in monocyte differentiation^ref. Statin treatment was recently shown to down-regulate CCL2 / MCP-1 production in vitro and in vivo^ref
• IL-1ß was identified as 1 of 25 genes whose expression were upregulated in CAD and downregulated by statins^ref
• mevalonate-independent :
• several statins (including simvastatin) are capable of blocking the CD11aCD18 / LFA-1 / a_Lb₂ integrin–ICAM-1 interaction, providing a mevalonate and thus HMG-CoA reductase–independent pathway for anti-inflammatory and immunomodulatory statin actions, inhibiting costimulation of lymphocytes. Even a very short incubation of monocytes with simvastatin but not pravastatin resulted in reduced adhesion of monocytes to endothelium, with the latter not being reversible after addition of mevalonic acid. This effect might be explained by direct passive interaction of simvastatin with the metal ion–dependent adhesion site of LFA-1 I-domain that induces structural changes within the L-site region. This explanation is further substantiated by the absence of any effect of pravastatin on monocyte adhesion (with pravastatin known to differ from simvastatin in that it does not interact with LFA-1)^ref.
• treatment of either cell type with atorvastatin, cerivastatin, or pravastatin (1 to 10 µmol/L) inhibited IFN-g plus TNF-a-stimulated CD40 expression by 50%, an effect that was not reversed by the HMG-CoA reductase product mevalonic acid (400 µmol/L). Transcription factor analysis revealed an inhibition by atorvastatin of NF-kB + STAT-1-dependent de novo synthesis of IRF-1, governing cytokine-stimulated CD40 expression in these cells. One consequence of this statin-dependent downregulation of CD40 expression was a decrease in CD40L-induced endothelial IL-12 expression^ref. Statins reduce the expression of CD40 on atheroma-associated cells in vitro, as well as on atherosclerotic lesions in situ in patients treated with statins^ref. These results have been confirmed by other investigators^{ref1, ref2}. Since CD40 and its ligand CD154 have been implicated in several crucial immunologic pathways, these latest results, together with observation of the reduced MHC-II expression, provide even more evidence that statins have the potential to modulate the immune system^ref. Elevated CD40L levels in patients with hypercholesterolemia and ACS, and elevated sCD40L levels have been associated with increased risk of cardiovascular events. Statins, glitazones, gpIIb/IIIa inhibitors, and clopidogrel have been demonstrated to effectively reduce CD40L levels both in vitro and in vivo. Abciximab has been shown to reduce the occurrence of death or myocardial infarction during 6 months of follow-up in patients with ACS who had the highest levels of sCD40L^ref.
• simvastatin dose-dependently reduced monocyte CCR2 mRNA and protein expression. Treatment of 21 normocholesterolemic men with simvastatin (20 mg/d for 2 weeks) decreased CCR2 protein and mRNA expression in circulating monocytes. Promoter and EMSA showed that simvastatin activated a peroxisome proliferator response element in THP-1 monocytes. Moreover, simvastatin-induced CCR2 downregulation was completely reversed by the synthetic PPAR-g antagonist GW9662. Simvastatin-treated monocytes showed little chemotaxis movement in response to CCL2 / MCP-1, a specific CCR2 ligand. Treatment of C57/BL6 mice with simvastatin (0.2 µg/g body weight IP, daily for 1 week) inhibited transmigration of CD80⁺ monocytes to the MCP-1–injected intraperitoneal space. Moreover, few circulating inflammatory cells from simvastatin-treated Sprague-Dawley rats (0.2 µg/g body weight IP, daily for 2 weeks) were recruited to the aortic wall of hypercholesterolemic littermates^ref.
• simvastatin promotes plaque stability in apoE^-/- mice, independently of cholesterol lowering. In this model, cholesterol-lowering effects can be presumed minimal, because hypercholesterolemia is primarily due to increases in chylomicron remnants and VLDL, which cannot be cleared by hepatic LDLRs or LRP via high-affinity binding to apoE. The absence of significant cholesterol-lowering by statins in this model has been experimentally validated before and used to demonstrate cholesterol-independent anti-inflammatory effects of simvastatin^ref. Surprisingly, in a longitudinal experiment spanning a much longer period (24 weeks), a significant temporary increase in plasma cholesterol was observed, the reason for which remains unknown. Although the extent of atherosclerosis increased over time in both groups and the higher plasma cholesterol level in the treatment group was associated with a consistent trend toward larger lesions, the frequency of bleeding into plaques of the brachiocephalic (innominate) artery was markedly reduced by statin treatment after 6 weeks and showed a 49% reduction when all time points were analyzed together. This was accompanied by an even greater reduction of intraplaque calcification. Animal models of plaque rupture have been severely criticized in the past, and none more than murine models^ref. It is now well established that several transgenic and knockout models develop advanced atherosclerotic lesions not only in the aortic origin, where particular anatomic and hemodynamic conditions may influence its pathogenesis, but throughout the entire aorta, major aortic branch sites, and coronary arteries^{ref1, ref2,ref3, ref4, ref5}. The occurrence of plaque rupture in mice has long been denied, but again "the mouse may get the last laugh"^ref. Superficial and deep plaque erosion, intraplaque bleeding, occasional thrombi originating from the necrotic core of advanced atheroma, and blood-filled channels consistent with revascularization of a ruptured plaque have all been described in mice^{ref1, ref2, ref3, ref4}. However, substantial anatomical, physiological, and hemodynamic differences between human and murine plaques impose a very cautious extrapolation of the results obtained in murine models to humans. For example, the murine media consists of just a few cell layers and their lesions have a far greater propensity to invade the media, often resulting in the formation of aneurysms. Murine lesions fitting the definition of early fatty streaks, ie, consisting mainly of foam cells, frequently cause significant stenosis that may lead to altered flow and shear stress, whereas equivalent lesions in humans have negligible hemodynamic consequences. Pronounced sex differences in immune-related functions are also increasingly noted in mice, and differences between human and murine coagulation system may exist^ref. Nevertheless, human and murine vulnerable plaques have many common features and manifestations of plaque instability may be less different than presently assumed. Murine models would be particularly attractive because of the relative ease with which genes implicated in atherogenesis, arterial remodeling, and plaque rupture can be manipulated in mice, and because microarrays are available that permit the simultaneous assessment of the differential expression of many murine genes in vivo^ref.


Plaque evolution in humans and mice. Regardless of the underlying anatomical and hemodynamic differences, initial plaque formation appears to be similar in humans and murine models with extensive hyperlipidemia. Common features include the progression to atheroma with a single fibrous cap and the presence of activated macrophages secreting metalloproteinases that may waken the cap in rupture-prone areas. However, the manifestations of plaque disruption in humans differ from those in mice. In humans, the most frequent event associated with clinical sequelae is a rupture of the fibrous cap leading to the formation of thrombi that cause partial or complete occlusion of the lumen and/or downstream embolization. Some thrombi may also be formed as a result of plaque erosion in humans. In contrast, in apoE^-/- and LDLR^-/- mice, plaque instability mainly takes the form of erosion and intraplaque bleeding without thrombus formation. Plaque ruptures associated with thrombosis occur, but seem to be far less frequent than in humans. Rupture of human plaques, even if clinically silent, results in the transition to larger, complicated plaques. Remodeling of murine arteries following deep erosion or rupture is poorly understood. Repeated erosions have been postulated to cause accelerated lesion growth^ref and may be responsible for the prevalence of lesions with multiple cap-like structures in mice, although similar lesions have also been observed in humans. Recent data in apoE^-/- x SR-BI^-/- mice suggest that a much greater incidence of murine plaque instability and shifts toward rupture/thrombosis are achievable in murine models. This should be helpful in determining to what extent the apparent differences in plaque instability and remodeling reflect fundamental differences in pathogenic mechanisms. The brachiocephalic artery is particularly prone to atherogenesis and bleeding^{ref1, ref2, ref3} and shows a high frequency of plaques with multiple cap-like structures. Although alternative explanations exist^ref, such lesions may indicate repeated episodes of rupture and rapid lesion growth^ref. In the mouse, these lesions are more frequent than classical atheromas with a single fibrous cap, but they are also seen in humans. Given the surprisingly high frequency of erosion and rupture, it is puzzling that Bea and colleagues did not observe intraluminal thrombi that were noted at this site by other investigators^{ref1, ref2}. The low incidence of plaque rupture and spontaneous thrombosis in other murine arteries^ref and the lack of fibrin accumulations is one of the main arguments held against murine models. This clearly constitutes a major practical obstacle for studies of spontaneous plaque rupture, but one that may not persist for long. Already, several reports have appeared in the literature that artificially enhanced plaque vulnerability and/or increased the frequency of their rupture by exogenous interventions^{ref1, ref2}. Induced myocardial infarction, albeit without signs of plaque rupture, have also been described^ref. One may challenge such manipulations as not being representative of pathogenic mechanisms leading to the vulnerable plaque in humans or its rupture^ref. Most importantly, the crucial clinical consequences–occlusive thrombi resulting in infarction and death–have not been seen in these mice. However, better mouse models that may overcome these important objections are on the horizon. Crosses between apoE^-/- mice and mice deficient for the scavenger receptor BI (SR-BI^-/-) developed by Krieger’s group are characterized by very early and extensive atherogenesis, even when fed normal chow^ref. Their coronary atherosclerosis is comparable to that in 2-year-old apoE mice^ref and shows extensive fibrin deposits indicative of plaque hemorrhage and coagulation. Most importantly, this is associated with multiple spontaneous infarctions with characteristic ECG abnormalities, enlarged hearts, defects of myocardial function (reduced ejection fraction and contractility), tissue necrosis, and death^ref. This should finally put to rest the notion that mice cannot be models of plaque rupture, just as the development of the apoE mouse put to rest the dogma that mice cannot develop "real" atherosclerotic lesions. It also proves in principle that conditions in mice can be modulated to the point where their pathogenic events mimic those in humans. This should stimulate the development of other models. Nevertheless, models closer to the human may still be needed to corroborate results obtained in mice. It will probably be only a matter of time until the apoE^-/- x SR-BI^-/- model will be used to investigate the mechanisms predisposing to plaque rupture and to assess the protective effect of statins. In the meantime, the results of Bea et al^ref provide the first in vivo evidence that statins reduce plaque vulnerability independently of cholesterol lowering. However, several caveats have to be kept in mind. The first is the relatively high dose of statins in this and other studies. Although a faster drug metabolism in rodents may attenuate the physiological significance of this discrepancy, the implications in terms of the accumulation of statins or active metabolites in cellular membranes and lipid-rich tissues in general remain a concern. Another caveat regards the temporary rise in cholesterol. The presumption is that statins inhibit HMG-CoA reductase and consequently the synthesis of both cholesterol and isoprenoids in mice, as they do in humans, and that the lack of reduction of murine plasma cholesterol levels is solely attributable to the prevalence of lipoprotein particles lacking the ligand for hepatic LDL receptors. If, however, the rise in cholesterol was not coincidental and the effect of statins on the mevanolate pathway were different from that in humans, the relevance of the model and the present findings would be questionable. In vivo evidence for genuine pleiotropic effects of statins is sparse. The present article adds reduced calcification, but offers no additional insights into the mechanisms actually responsible for plaque instability. Cholesterol-independent effects of statins on lesion composition that could contribute to weakening of the cap have previously been established in monkeys^ref. Macrophage-secreted metalloproteinases are thought to be an important cause of fibrous cap weakening^ref, although the impact of individual enzymes has not been established^{ref1, ref2, ref3}. This assumption is strengthened by the observation that pravastatin treatment increases collagen content and decreases lipid content, inflammation, metalloproteinase expression, and cell death in human carotid plaques^ref. However, other protective effects of statins on macrophages, T cells, and inflammatory conditions prevailing in plaques and potentially contributing to plaque rupture^ref cannot be ruled out. Clearly, much more work will be necessary to establish that specific pleiotropic effects of statins contribute to reduced plaque vulnerability and rupture in humans^ref. Atherogenesis involves the migration of monocytes into the subendothelial space^ref, where they adhere to matrices containing oxidized LDLs (oxLDLs), mature into macrophages, and secrete growth factors, proteases, and ROS^ref.
• reduce inflammatory biomarkers such as :
• CRP^ref : there is now compelling evidence that statin therapy may attenuate the effect of inflammation on risk of cardiovascular events. Among 708 postinfarction patients in the Cholesterol and Recurrent Events (CARE) trial, subjects with elevated levels of CRP and SAA (>90th percentile) had a higher risk and benefited more from therapy with pravastatin 40 mg/d than those without elevated levels of these inflammatory markers. The relative risk of a recurrent coronary event was reduced by 54% and 25% in the 2 groups, respectively, compared with placebo^ref. At baseline, both subsets had nearly identical plasma lipid and lipoprotein profiles. Long-term therapy with pravastatin in the CARE trial also reduced levels of CRP in postinfarction patients^ref. Although baseline median CRP levels for active treatment and placebo were similar, the median level after 5 years was 21.6% lower in the pravastatin group than in the placebo group (P=0.007). The change in CRP levels associated with pravastatin treatment was not correlated with the reduction in LDL-cholesterol levels. The latter finding has been confirmed in the recent 24-week prospective Pravastatin Inflammation/CRP Evaluation (PRINCE) trial^ref. A 6-week triple crossover trial compared the effect of pravastatin, simvastatin, and atorvastatin therapy on hs-CRP levels in patients with combined hyperlipidemia^ref. All 3 drugs, at doses reported to have equivalent effects on LDL-cholesterol, significantly reduced median hs-CRP levels (pravastatin by 20%, simvastatin by 23%, and atorvastatin by 28%), and these reductions were not correlated with reductions in LDL-cholesterol. This study is in contrast to the negative result of a similar comparison using a parallel design and a 3-month exposure with a smaller number of subjects in each subset^ref. In the Atorvastatin versus Simvastatin on Atherosclerosis Progression (ASAP) study, aggressive statin therapy (atorvastatin 80 mg) reduced CRP levels to a greater extent than conventional therapy (simvastatin 40 mg)^ref. Moreover, a significant correlation was found in univariate analysis between the decrease in CRP and the reduction of intima media thickness (IMT) of carotid artery segments. A recent study showed that simvastatin lowered CRP within 14 days^ref, independently of LDL-cholesterol reduction. Rapid reductions in CRP levels with statins could explain in part the early beneficial effects of these drugs in acute coronary syndromes^ref.
• anti-heat-shock proteins (HSPs)-60, -65, and -70 antibody titers, positively related to risk of vascular disease and cardiovascular endpoints, are significantly higher in dyslipidemic patients with or without established coronary disease. In dyslipidemic patients, the major dietary predictors of the variability in anti-HSP-60 titers were vitamin C, vitamin E, and total fat intakes; for anti-HSP-65 titers, vitamin C was the major predictor^ref. 10 mg of simvastatin or atorvastatin for 4 months significatively reduced median antibody titers to HSP60 (17.2%), HSP65 (15.9%) and HSP70 (8.3%) in dyslipidemic subjects. Both statins caused a reduction in median serum CRP concentrations (45%), but significant changes were not observed in the control patients. The effects on Hsp antibody titers were not related to changes in serum CRP concentrations (p > 0.05). However, there was a significant correlation between changes in antibody titers to HSP60 vs HSP65, Hsp-60 vs Hsp-70, and HSP65 vs HSP70^ref.
• stimulate secretion of caspase-1, IL-1b and IL-18 in PBMC in response to Mycobacterium tuberculosis
• decrease IL-6 synthesis in human vascular smooth muscle cells (VSMC) in vitro^ref
• inhibit of scavenger receptors :
• lovastatin inhibits gene expression of type-I scavenger receptor in THP-1 human macrophages^ref
• pitavastatin (NK-104) prevents OxLDL uptake by macrophages through PPARg-dependent inhibition of CD36 expression by murine macrophages and suggest that pitavastatin could modulate CD36-mediated atherosclerotic foam cell formation^ref
• isolevuglandins (isoLGs) are a family of reactive g-ketoaldehydes generated by free radical oxidation of arachidonate-containing lipids through the isoprostane pathway. Elevated plasma levels of isoLG protein adducts are observed in subjects with atherosclerosis compared with age/gender-matched controls. Free radical-induced peroxidation promoted by the myeloperoxidase (MPO)/H₂O₂ system of leukocytes serves as one mechanism for the generation of isoLGs in vivo. Using a Candida sepsis model of inflammation, 3.5- and 2.7-fold increases in iso[4]LGE₂ and isoLGE₂ adducts of plasma proteins after pathogen exposure in wild-type mice. Plasma levels of F₂ isoprostanes were not significantly increased after pathogen challenge in this model. MPO knockout mice demonstrated significant reductions (34%, P=0.003) in plasma levels of iso[4]LGE₂ protein adducts after pathogen challenge compared with wild-type mice. Mass spectrometry and immunochemical methods demonstrate MPO-dependent formation of iso[4]LGE₂ and isoLGE₂ phospholipids and their corresponding isoLG protein adducts in model systems. The present studies thus identify MPO as one pathway for generation of isoLGs in vivo. They also suggest that long-lived protein isoLG adducts may serve as an alternative integrated sensor of oxidant stress in vivo^ref
• reduce the formation of superoxide and other oxygen radicals that modulate many intracellular signaling pathways^ref
• decrease the expression of tissue factor in lesions, reduce platelet activation, and improve fibrinolytic activity through preservation of endothelial function, but it is unclear whether these effects are common to the entire class of statins, because some compounds seem to exert opposite effects^ref
• reduce plasma cholesteryl ester transfer protein, plasma (CETP) activity, which transfers cholesteryl ester to VLDL and LDL^ref. With only few exceptions^ref simvastatin and pravastatin decrease plasma CETP activity in normolipidemic individuals and patients with various forms of hyperlipoproteinemia^{ref1, ref2, ref3}. The mechanism responsible for this effect is unknown, but could mediate some of the effects of statins beyond CETP effects on lipid metabolism. Indeed, a significant relation between variation at the CETP gene locus and the progression of coronary atherosclerosis has been demonstrated. Moreover, the presence of a common DNA variant of the CETP gene appears to predict benefit from treatment with statins in men with coronary heart disease (CHD)^ref.

effect of statins on :		cholesterol independent ? (no indicates a significant decrease in plasma cholesterol in in vivo studies rather than evidence for cholesterol-dependent mechanisms)
		in vitro	in vivo	species
endothelial function / vasotonus	inhibition of endothelin 1 expressionref	yes
	increased expression and activity of endothelial nitric oxide (NO) synthaseref1, ref2	yes
	stroke protection mediated by endothelial NO synthaseref	yes	yes	mouse
	preserved coronary endothelial function and coronary adventitial vasa vasorumref1, ref2		yes	pig
	preserves myocardial perfusion and coronary microvascular permeabilityref		yes	pig
macrophage and T cell recruitment / modulation of immune functions	decreased leukocyte-endothelial interactionsref		yes	rat
	decreased CD11b expression and CD11b-dependent endothelial adhesion of human monocytesref	yes		human
	inhibition of endothelial cell and monocyte MCP-1 synthesis and leukocyte recruitment into air pouchref	yes	yes	mouse
	decreased integrin-dependent leukocyte adhesionref	yes
	inhibition of T cell activation through inhibition of MHC-II expression on APCsref	?
	inhibition of leukocyte adhesion, T cell stimulation, and peritoneal inflammation by inhibition of LF-1 (CD11a/CD18)ref	yes	yes	mouse
proinflammatory factors	inhibition of natural killer cell cytotoxicity by compactinref	yes
	inhibition of macrophage NO synthase and cytokines TNF, IL-1ß, IL-6ref	yes
	inhibition of human B-lymphocyte activationref	?
	reduced neointimal inflammationref		no	rabbit
	anti-inflammatory and anti-atherosclerotic effectsref		yes	mouse
	reduction of IL-1ß, IL-6, COX-2, and PPAR mRNA in endothelial cellsref	?
	reduced IL-6 synthesis in VSMCsref	yes
	reduced MMP-9 secretion by macrophagesref	?
	suppression of growth of macrophages expressing matrix metalloproteinases and tissue factorref	?	no	rabbit
SMC proliferation / apoptosis of arterial cells / remodeling of the arterial wall	decreased VSMC proliferationref	yes
	increased apoptosis of VSMCsref	yes
	increased SMC and collagen, and decreased metalloproteinases in atheromaref		no	rabbit
	modulation of angiogenesisref1, ref2 (opposite effects reported)	?	?	rabbit
	decreased metalloproteinase and increased collagen expression in plaquesref		no	human
	decreased secretion of MMP-9 and THP-1 cell migrationref	yes
generation of oxygen radicals and modulation of oxidation-sensitive signaling	decreased LDL oxidation by macrophagesref	?
	decreased SMC superoxide formation and reduced cardiac hypertrophyref	yes	yes	rat/mouse
	reduced production of ROS and improved endothelial dysfunction in normocholesterolemic hypertensionref		no	rat
thrombosis / fibrinolysis	increased fibrinolytic activity in endothelial cellsref	yes	yes (after 2 days of treatment)	rat
	decreased platelet activation and reduced cerebral ischemiaref		yes	mouse
	inhibition of tissue factor expression in macrophagesref69	yes
	reduced tissue factor expression in carotid lesionsref		yes	rabbit
	reduced expression of COX-2 in the intima and in cultured VSMCsref	yes	no	rabbit
clinical trials – mechanisms unknown	clinical outcomes not entirely explained by cholesterol-lowering (reduction of strokes, protective effects at ‘normal’ cholesterol levels, etc)ref1, ref2, ref3, ref4		no	human
	improvement of clinical outcomes after relatively short treatment periodref1, ref2		no	human
	reduced graft atherosclerosis and mortality after heart transplantationref1, ref2		no	human
	reduced death after percutaneous coronary interventionref		no	human

Clinical applications : treatment of autoimmune diseases even under normocholesterolemic conditions^ref
• treatment of multiple sclerosis^{ref1, ref2} - and in particular to the mouse model  termed experimental autoimmune encephalomyelitis (EAE)—are particularly interesting and not entirely unexpected. Oral statin treatment prevents or reverses chronic and relapsing paralysis and suppresses clinical and histological EAE : in these experiments, statin treatment reduces CNS infiltration (T_h1 lymphocytes) and MHC class II expression, inhibits the activity of CD40, CD80, and CD86 co-stimulatory molecules, largely inhibits the secretion of numbers of proinflammatory cytokines [for example, TNF-a, IFN-g, IL-12], and even induces the production of anti-inflammatory cytokines [such as TGFß and IL-10]. In addition, statin treatment of either APC or T lymphocytes from EAE-susceptible mice suppressed antigen-specific T-cell activation. These statin-mediated effects are specific for the inhibition of the enzyme HMG-CoA reductase. Statins may be beneficial for multiple sclerosis and other T_h1 lymphocyte-mediated autoimmune diseases^ref. These findings were largely confirmed in another recent report published by Neuhaus et al.^ref. It is important to bear in mind that one of the current treatments of choice for multiple sclerosis, IFN-ß, also inhibits expression of MHC class II, although the exact mechanism is unknown. Investigations on possible synergy between statins and IFN-ß treatment on immunomodulation and proinflammatory molecules are currently being explored and may result in novel therapeutic strategies to influence the clinical issue of multiple sclerosis.
• Mach et al have recently observed, for instance, remarkable effects of statins in mice models of skin transplantation and of collagen-induced arthritis
• mice treated with simvastatin and rendered septic by cecal ligation and perforation (CLP) show a mean survival time close to 4 times the value found in untreated mice. This dramatic improvement is based on a complete preservation of cardiac function and hemodynamic status^ref.
Risks vs. benefits : although it is to be hoped that statins may prove to be clinically useful in autoimmune diseases, one should also keep in mind that some degree of immunosuppression over a very long time period might have negative consequences. It is thus relevant to mention that in the recent human clinical trial PROSPER, it was reported that the use of statin in elderly individuals might increase the risk of cancer^ref. Nonetheless, the future seems bright for the statin family in immune regulation^ref. In the last decades, substantial progress has been made in understanding the relationship between lipid disorders and the prevention of cardiac ischemic disease^ref.

Direct pharmacological inhibition of expression of MHC class II, acting either on CIITA or on the 3 other MHC class II-specific transcription factors that form the regulatory factor X (RFX) complex^ref, should be explored.
Despite the known benefit of statin therapy, many cardiac patients abruptly discontinue therapy because of financial constraints, forgetfulness, or side effects. More recently, several studies have shown that abrupt cessation of statin therapy during treatment could increase the incidence of cardiac events in patients with atherosclerotic heart disease. However, the mechanisms of the increased incidence of cardiovascular events after abruptly stopping statin therapy are still unknown. A few data suggest that abrupt withdrawal of statin therapy deteriorates endothelial function, result in expression of pro-inflammatory gene involved in the development and progression of atherosclerosis. This rebound phenomenon of inflammatory response may be a major mechanism responsible for increased cardiovascular events after abrupt cessation of statin therapy. Abrupt termination of statin therapy resulted in a rapid increased CRP and IL-6 levels in patients with hypercholesterolemia. This finding may be of important interest in the connection between inflammatory response and abrupt withdrawal of statin therapy in patients with coronary artery disease^ref.
• Immune system enhancers (ISEs) / immunostimulants / immunopotentiation / immuno-augmentation (see also cytokines replacement therapy) are used in treatment of ...
• infections
• immunodeficiencies
• cancer
Because IL-1b mRNA expression is closely associated with DC activation, DCs were engineered to stably express a fluorescent marker gene under the control of IL-1b promoter. By screening ~3,000 compounds with the resulting DC biosensor clone, the DC-stimulatory potentials of topoisomerase I inhibitors (camptothecin derivatives) and microtubule depolymerizing drugs (colchicine and podophyllotoxin) were identified. In response to treatment with each agent, bone marrow-derived DC preparations exhibited characteristic phenotypic and/or functional changes associated with DC activation. All the above agents also triggered NFkB activation in DCs, suggesting a common pharmacological mechanism of action. Furthermore, locally administered colchicine induced in situ maturation and migration of DCs and augmented both humoral and cellular immune responses. These results support the practical utility of the DC-based biosensor system to discover novel DC-targeted immunostimulants and unveil previously unrecognized (and totally unexpected) pharmacological activities of several drugs that are commonly used for the treatment of various disorders^ref.
• levamisole (LMS) / (--)-2,3,5,6-tetrahydro-6-phenylimidazo[2,1-b]thiazole (Decaris^®, Ergamisol^®)


It is an antihelminthic which increases NK cells and activated T-cells : levamisole had no consistent effect on induction of 2',5'-oligoadenylate synthetase activity or indoleamine-2,3-dioxygenase (IDO) activity, or production of TNF. Levamisole had no effect on monocyte cytotoxicity or expression of HLA-DR, HLA-DQ, HLA-DP, and the Fc receptor. Similarly, levamisole had no significant effect on NK or LAK cytotoxicity or the immunological activation of T-lymphocytes, assessed by expression of CD3, CD4, CD8, CD16, CD25, and CD56. Proliferation of lymphocytes from normal donors, patients with benign polyps, and patients with malignancies, with or without IL-2 or irradiated LS174T cells, was not significantly increased overall. No significant enhancement in the expression of 3 tumor-associated antigens (880364, NRCO-4, and ING-1) and ICAM-1 on 4 human cancer cell lines was observed following in vitro exposure to levamisole. Anaerobic bacteria from human intestinal flora (expecially Bacteroides and Clostridium spp.) catabolyze levamisole into 3 hydroxamic lactam-type, thiazole ring-opened metabolites, namely, levametabol-I, II and III. LMS decomposes during storage in neutral and alkaline conditions to form 3 products : 3-(2-mercaptoethyl)-5-phenylimidazolidine-2-one, 2,6-phenyl-2,3-dihydroimidazo (2,1-b) thiazole and bis [3-(2-oxo-5-phenylimidazolidin-1-yl) ethyl] disulfide. The formation of the products is accelerated by increasing the temperature from 4 to 37°C. Used to contaminate cocaine
• isoprinosine / inosine pranobex (InPx) / metisoprinol (Inosiplex^®, Isoprinosine^®) is a synthetic compound formed from the p-acetamido benzoate salt of N-N dimethylamino-2-propanol and inosine in a 3:1 molar ratio. It increases natural killer (NK)-cell activity, total T cells, and T-helper cells, with certain effects persisting for months after completion of the treatment period. It is used in therapy of HIV-1 , HHV-1 / HSV-1, rhinoviruses, HHV-3 / VZV, HBV, and SSPE virus infections.
• thalidomide (Thd) / a-N-phthalylglutaramide / 2-(2,6-dioxo-3-piperidinyl)-1H-isoindole-1,3(2H)-dione (Distaval^®, Thalomid^®). M_r = 258.24. The R stereoisomer has therapeutical properties as sedative and antinausea drug, while the S stereoisomer is teratogenic. It has activity in the treatment of Waldenstrom's macroglobulinemia (WM), as well as multiple myeloma, myelodysplastic syndrome, myelofibrosis with splenic myeloid metaplasia, chronic lymphocytic leukemia (CLL), and B-cell lymphomas. Although its molecular mechanisms of action have not yet been elucidated, thalidomide and the IMiDs affect a variety of cytokines and inflammatory mediators including TNF-a, IL-1b, IFN-g, IL-6, IL-10, IL-12, and COX-2 and angiogenesis factors such as VEGF and VEGFRs. It was originally proposed as a potential therapy for refractory MM because of its known anti-angiogenic activity and the demonstration of increased angiogenesis in MM BM^{ref1, ref2}. In addition, Thal and IMiDs induce either apoptosis or G₁ growth arrest of MM cells by multiple other mechanisms^ref. They block MM cell adhesion to BMSCs and the resultant secretion of MM growth, survival, and migratory factors (IL-6, VEGF); and enhance NK cell number and function against human MM cells^ref


Schedule : 200 mg/day PO daily at bedtime : dose increase every 2 weeks for 6 weeks up to a dose of 800 mg/day.
Side effects : anemia grade 3-4 (4%), thrombocytopenia (4%), emetogenic level 1^ref, neuropathy^{ref1, ref2, ref3, ref4}, teratogen (phocomelia) when used as antiemetic or sedative in pregnants, grade 4 WHO neutropenia with septicemia^ref
• thalidomide analogs :
• Immunomodulatory Drugs (IMiDs^®) co-stimulate T cells by potentiating AP-1 transcriptional activity and act like thalidomide. The IMiDs also affect adhesion molecules such as ICAM-1, ICAM-2, and L-CAM, in addition to preferentially stimulating CD8 CTLs and expanding NK cell populations
• CC-4047 / pomalidomide (Imnovid^®, Pomalyst^®, Actimid^®)
• CC-5013 / lenalidomide (Revlimid^®, Revimid^®; source : Celgene Corp.)^ref: a 4-amino-glutarimide thalidomide analogue, has hematologic activity in patients with low-risk myelodysplastic syndromes (MDS) (associated with a chromosome 5q deletion) who have no response to erythropoietin or who are unlikely to benefit from conventional therapy^ref


CC5013 differs from thalidomide by the removal of a ketone and addition of an amino group to the glutamate aromatic ring. The addition of lenalidomide to SGN-40 enhances cytotoxicity against multiple myeloma cells, providing the framework for combined lenalidomide and SGN-40 in a new treatment paradigm to both target MM cells directly and induce immune effectors against MM^ref
Side effects : as first line or salvage treatment, lenalidomide combined with high-dose dexamethasone was associated with high response rates and almost no severe neurotoxic effects. However, severe neutropenia occurred in 12-16.5% of patients and thrombosis^ref
• Selective Cytokine Inhibitory Drugs (SelCIDs^®) are potent PDE-4 inhibitors that inhibit activation-induced TNF-a production and are highly antiangiogenic. In addition, inhibition of PDE-4 induces apoptosis in human CLL lymphocytes and has anti-inflammatory properties. Moreover, a subset of SelCIDs has been found to posses direct anti-tumor activity both in vitro and in vivo.
• CC-3052
• phosphodiesterase-5 (PDE5) inhibitors (sildenafil, tadalafil, and vardenafil) are agents currently in clinical use for nonmalignant conditions. In several mouse tumor models, PDE5 inhibition reverses tumor-induced immunosuppressive mechanisms and enables a measurable antitumor immune response to be generated that substantially delays tumor progression. In particular, sildenafil, down-regulates arginase 1 and NOS2 expression, thereby reducing the suppressive machinery of CD11b⁺/Gr-1⁺ myeloid-derived suppressor cells (MDSCs) recruited by growing tumors. By removing these tumor escape mechanisms, sildenafil enhances intratumoral T cell infiltration and activation, reduces tumor outgrowth, and improves the antitumor efficacy of adoptive T cell therapy. Sildenafil also restores in vitro T cell proliferation of peripheral blood mononuclear cells from multiple myeloma and head and neck cancer patients. In light of the recent data that enzymes mediating MDSC-dependent immunosuppression in mice are active also in humans, these findings demonstrate a potentially novel use of PDE5 inhibitors as adjuncts to tumor-specific immune therapy^ref.
• universal contact-sensitisers which induce type IV hypersensitivity have been been used to treat cutaneous neoplasms
• dinitrochlorobenzene (DNCB)


• diphencyprone (DCP)
• squaric acid dibutyl ester (SADBE)
• triethyleneiminobenzoquinone
• TLR agonists : one advantage of the synthetic compounds is that they are less likely to be contaminated with minor, but potent, bacterial products that may mislead the investigator, as has been an occasional confounding problem with LPS^{ref1, ref2}
• TLR3 agonists :
• poly(I):poly(C12U) / atvogen (i.v. Ampligen^®, p.o. Oragen^®; source : Hemispherx), an interferon inducer, is active against HIV in vitro. In the US, Ampligen^® has been granted orphan drug status for the treatment of AIDS, renal cell carcinoma (phase II, completed), chronic fatigue syndrome (phase III) and invasive/metastatic malignant melanoma (phase II)^ref. Poly(I):poly(C12U) does not induce measurable levels of interferon and causes only minimal biologic or toxic effects among those parameters measured after administration of a single dose in the 200- to 600-mg dose range in health volunteers^ref.
• TLR4 agonists^ref :
• monophosphoryl lipid A (MPL) (Corixa Corporation), which is a derivative of lipid A from Salmonella minnesota, has proven to be safe and effective as a vaccine adjuvant in > 120,000 human doses
• synthetic lipid A mimetics :
• aminoalkyl glucosaminide 4-phosphates (AGPs) (Corixa Corporation)^ref
• RC524
• RC529 / Ribi.529^{ref1, ref2}
• ER-112022 is a phospholipid dimer connected via an acyclic backbone. Each monomeric unit contains 3 unique fat groups that are bound indirectly to a phosphate diester. The fat groups include a 10-carbon ether chain, an unsaturated 12-carbon, acyloxy chain bound to the ether chain, and a 14-carbon, b-oxo-amide chain linked closer to the phosphodiester. Thus, the compound has 3 unique features compared with naturally occurring lipid A from E. coli. First, ER-112022 is devoid of a cyclic carbohydrate backbone. Second, the phosphates are phosphodiesters incorporated within the confines of the structural backbone, unlike the phosphoesters on E. coli lipid A, and finally, the structure is symmetrical^ref


• TLR7agonists : mainly derivatives and analogs of guanine. Structure-activity studies within this class showed that structures in the thiazolo[4,5-d]pyrimidine^ref, pyrazolo[3,4-d]pyrimidine^ref, purine^ref, 7-deazapurine^ref, and 9-deazapurine ring systems^ref all are active. Examples in each group were found to be potent antiviral agents in mouse models because of their ability to rapidly induce the production of IFN^{ref1, ref2, ref3}


• loxoribine / 7-allyl-7,8-dihydro-8-oxo-guanosine / RWJ-21757^{ref1, ref2} : primary adjuvant for antibody responses to a wide variety of antigen types in a variety of species. Typical dose in mice: 1-3 mg/25 g mouse. In humans: 10 mg/kg has been used safely. Main side effects noted resemble those of interferon and are transient. Augmentation of CTL-mediated, NK cell-mediated, macrophage mediated, and LAK cell-mediated cytotoxicity. Inducer of cytokines: IFN-a, IFN-b, IFN-g, TNF-a, TNF-b, IL-1a, IL-6. Up regulates humoral immune responses in immunodeficiency. Acts as a surrogate T_h signal.
• certain C⁸-substituted and N⁷, C⁸-disubstituted guanine ribonucleosides
• 7-deazaguanosine^ref
• 5-amino-3-b-D-ribofuranosylthiazolo[4,5-d]pyrimidine-2,7-dione
• thiazolopyrimidine (TZP) : alkyl and alkenyl guanine analogs containing a thiazolo[4,5-d]pyrimidine ring system prepared by reaction of the appropriate alkyl halide with the sodium salt of the heterocycle. Indications : rheumatoid arthritis, Crohn's disease
• 7-thia-8-oxoguanosine (TOG) / 5-amino-3-b-D-ribofuranosylthiazolo[4,5-d]pyrimidine-2,7(3H,6H)-dione / 5-aminothiazolo[4,5-d]pyrimidine-2,7-dione^{ref1, ref2}
• T70072^ref
• T01132
• TEI-3096 [6-p-chlorobenzyl-5H-2,3,6,7-terahydro-5,7-dioxothiazolo (3,2-a) pyrimidine]^ref
The stimulation of TLR7 by the guanosine analogs in human cells appears to require endosomal maturation because inhibition of this process with chloroquine significantly reduced the downstream activation of NF-kB^ref
• bropirimine / 5-halo-6-phenyl-pyrimidinone (PNU-54461) (Remisar^®) and its analogues :
• PNU-54462
• PNU-56359
• PNU-56169
• PNU-63693
UGT1A9 and to a lesser extent UGT1A1 are responsible for the majority of bropirimine O-glucuronidation in man
• 8-hydroxyadenine derivatives :
• 2-substituted 8-hydroxyadenines^ref :
• 2-amino-8-hydroxyadenines : compound 9o induced IFN from the dosage of 0.1 mg/kg, which was 30-fold potent than that of Imiquimod, and showed a good oral bioavailability (F=81%)^ref
• 3a-d
• 9-substituted-8-hydroxyadenine derivatives :
• 9-benzyl-8-hydroxyadenine^ref
• 9-benzyl-8-hydroxy-2-(2-hydroxyethylthio)adenine (SM-295072)^ref
• 9ae / SM-276001 is considered to be a promising compound as an orally active IFN inducer : it did not cause emesis in ferrets even at a dose of 30 mg/kg. In this study the maximum plasma concentration of 9ae was 1019 ng/mL (ca. 3.1 muM), which was approximately 1000-fold higher than the MEC value. It has a minimum effective concentration (MEC) of 3 nM, which is comparable with that of R-848, a second generation IFN inducer. Compound 9ae also demonstrated potent IFN-inducing activity at a dose of 0.1 mg/kg by oral administration in mice^ref
• imidazoquinolinamines / imidazoquinolines^ref :
• imiquimod / R-837 / S-26308 (1-(2-methylpropyl)-1-H-imidazo-[4,5-c]-quinolin-4-amine)) (5% cream formulation : Aldara^®; source : 3M Pharmaceuticals) for condyloma acuminatum, actinic keratosis (AK)^{ref1, ref2, ref3}, non-melanoma skin cancers such as basal cell carcinoma (BCC)^{ref1, ref2, ref3} and squamous cell carcinoma (SCC)^{ref1, ref2, ref3}, lentigo maligna / melanoma^{ref1, ref2, ref3,ref4}, keratoacanthoma^ref, molluscum contagiosum^{ref1, ref2, ref3}, localized morphea^{ref1, ref2} and fibromatoses^ref, infantile hemangioma^ref, cutaneous T-cell lymphoma^ref. In keratinocytes it upregulates IL-6 and IL-8 in vitro^ref. Hydroxylated to R-842^ref. It is also an antagonist on A₁ and A_2A inducing activation of NF-kB and the downstream production of proinflammatory cytokines in the absence of TLR7 and TLR8 and in the absence of immune cells, and inhibiting adenylyl cyclase activity downstream from the receptor^ref

Side effects : angioedema^ref, localized pemphigus foliaceus^ref, acute urinary retention^ref
• resiquimod / R-848 / S-28463 (1-(2-hydroxy-2-methylpropyl)-2-methyl-1H-imidazol[4,5-c]quinolin-4-amine / 4-amino-a-dimethyl-2-ethoxymethyl-1-H-imidazol-[4,5-c]-quinoline-1-ethanol) (topical 0.1–1.0% gel; source : 3M Pharmaceuticals). In keratinocytes it induces mRNA for IL-1, IL-8, TNF-a and transiently IFN-a^ref. It is also a TLR8 agonist in human cells, but TLR8 in the mouse is nonfunctional^ref. Catabolized to S-28371.


• S-27609^{ref1, ref2, ref3, ref4}
• 3M-001 and 3M-003 (also a TLR8 agonist)^ref
• linomide / roquinimex (a quinoline derivative with pleiotropic immunomodulatory activity, enhances natural killer (NK) cell number and activity after ABMT in patients with AML.; but failed in MS) => laquinimod / ABR-215062 (source : Active Biotech & Teva) : clinical trials for multiple sclerosis^ref


• leflunomide (Arava^©), an inhibitor of pyrimidine synthesis, and its metabolite, A771726 / teriflunomide (also EGFR antagonist)
• apilimod / STA-5326 (source : Synta Pharmaceuticals) : oral inhibitor of IL-12/IL-23 transcription achieved by preventing c-Rel from entering the nucleus where it acts as a transcription factor and helps stimulate IL-12 mRNA production, selectively abrogating T_h1 resposes^ref. Clinical trials for Crohn's disease^ref, autoimmune disaese and CVID


• anagrelide is an oral imidazoquinazoline agent that has been shown to reduce elevated platelet counts and the risk of thrombosis in patients with thrombocythaemia in various myeloproliferative disorders (MPD)
Peripheral blood mononuclear cell cytokine induction by imiquimod in vivo required tyrosine and PKC activity, was independent of cellular protein synthesis and was mediated via the transcription factors NFkB and 4F1^ref. Furthermore, mice lacking a component of the IFN-stimulated gene factor 3, termed STAT-1, lacked imiquimod-mediated gene activation^ref. Patients responding to topical imiquimod treatment of genital warts had higher constitutive pretreatment levels of STAT-1^ref. Hence, imiquimod modulates IFN signal transduction to enhance transcription of IFN-g stimulated genes.
Langerhans' cells (LC) demonstrated functional activation and enhanced induction of T-lymphocyte proliferation in response to imiquimod or resiquimod treatment^ref. LC migration to draining lymph nodes was also enhanced, which could facilitate antigen presentation to T-lymphocytes^ref. A T_h1 cytokine profile, including IFN-g, was preferentially induced in mitogen-stimulated T-lymphocytes exposed to imiquimod or resiquimod^ref. This was mediated by upregulation of IFN-a and IL-12 in monocytes and macrophages, an effect seen to a greater extent with resiquimod than with imiquimod treatment^ref. B-lymphocytes proliferated, became activated and were stimulated to produce immunoglobulin^ref. In these studies resiquimod was more potent at inducing lymphocyte proliferation and was also capable of aiding immunoglobulin class switching, unlike imiquimod^ref. These links between innate and acquired immune responses suggest the potential usefulness of imiquimod, and in particular, resiquimod, as agents that could enhance vaccine responses. Imidazoquinolinamines demonstrate indirect antiviral activity in vivo owing to cytokine induction, which inhibits viral replication directly and stimulates innate and acquired antiviral immune responses. In patients treated with 5% imiquimod cream, human papillomavirus (HPV) DNA and mRNA for the L1 gene were significantly decreased in association with a clinical response to therapy^ref. Animal models, case reports and open-label studies have variously demonstrated the antiviral effect of imiquimod against HSV, Rift Valley fever virus, Banzi virus and in the treatment of molluscum contagiosum^{ref1, ref2, ref3}. In most circumstances the observed antiviral effect has been associated with topical administration. The pharmacokinetics of topical administration are incompletely delineated but systemic absorption has not been detected, so the effect is local^ref. The cream is usually applied to clean dry skin and left for 6–10 h before being washed off. Resiquimod has greater potency at inducing cytokine expression than imiquimod but whether this will increase its antiviral spectrum is presently unknown. It may, however, be more useful than imiquimod in treating HSV-2 and may also be used in HCV infection^ref. In a guinea-pig model of HSV-2 infection, resiquimod was effective when administered by dermal, subcutaneous or intravaginal routes before infection^ref. Antiviral activity is related to induction of serum 2',5'-oligoadenylate synthetase activity. Resiquimod was also found to decrease recurrence of HSV-2 when administered subcutaneously in this model. Unlike imiquimod, for which pre-systemic biotransformation has limited its oral bioavailability, resiquimod may be administered by the oral route and trials are under way to assess its use in anti-HCV therapy, for which IFN- forms the cornerstone of therapy. Imiquimod 5% cream (Aldara) is licensed for the treatment of anogenital warts in immunocompetent patients. The evidence supporting this license comes from 3 prospective, double-blind, randomized, vehicle-controlled trials^{ref1, ref2, ref3}. In these trials 698 immunocompetent individuals were randomized to receive topical therapy with imiquimod 5% cream, 1% cream^{ref1, ref2} or vehicle control. The topical treatment was applied daily^ref or 3 times a week^{ref1, ref2} for 16 weeks or until lesions cleared. Complete clearance of warts was observed in 37–52% of those treated with 5% cream, 14–21% of those treated with 1% cream and 0–11% of those treated with vehicle control by intent-to-treat analyses^{ref1, ref2, ref3}. For complete responders, relapse rates at 10–12 weeks were 13–19% for 5% cream, 0–17% for 1% cream and 0–10% for vehicle control. Response rates were higher in female as compared with male patients. Local skin effects, including erythema, excoriation, flaking and erosion, were common but usually well tolerated. Ulceration was also noted in a minority of patients. These side-effects were associated with itching, pain and burning but systemic side-effects were not reported as occurring with greater frequency in the treatment group^ref. None of these studies analysed changes in HPV DNA. Subsequent clinical audit has demonstrated a similar response rate^ref. Therapy of anogenital warts in HIV-seropositive individuals has been less effective. In a randomized, double-blind, vehicle-controlled trial of imiquimod 5% cream administered 3 times a week in 100 HIV-seropositive individuals receiving antiretroviral therapy and with CD4 T-lymphocyte counts >100 x 10⁶ cells/L, complete response rates were seen in only 11% of the imiquimod group, compared with 6% of the control group, after 16 weeks of therapy, a result that was not statistically significant^ref. A 50% reduction in wart size was, however, demonstrated in 38% of those who received imiquimod as compared with 14% of controls (P = 0.01), and the therapy was well tolerated. The number of individuals in this study whose HIV RNA plasma copy number was undetectable was not stated. Further studies are needed to address how this response rate can be improved. In a further, double-blind, randomized, vehicle-controlled trial, 100 immunocompetent patients with molluscum contagiosum were randomized to receive a control or 1% imiquimod cream 3 times daily, 5 days a week for 4 weeks^ref. Clearance of lesions was demonstrated in 82% of the imiquimod-treated individuals but only 16% of controls. Relapse rates after 10 months of follow-up were very low. Resiquimod may also find a role in the treatment of HPV or molluscum contagiosum infection. In addition, it may be particularly useful against HSV-2, either as an agent to prevent recurrence or as a vaccine adjuvant in the presence of HSV glycoproteins. In a randomized study involving 52 immunocompetent individuals with a history of 6 or more recurrences of herpes genitalis per year, resiquimod demonstrated clinical efficacy. Resiquimod gel at various concentrations, or vehicle control, was administered to lesions within 24 h of onset and treatment continued for 3 weeks. The median time to first recurrence was 169 days for the combined resiquimod treatment group as compared with 57 days for the control group (P < 0.01). In the 6 months of follow-up 32% of the resiquimod but only 6% of the control group had no recurrences (P < 0.05). A European multicentre Phase III randomized double-blind study is currently determining the efficacy of 0.01% resiquimod gel at preventing recurrences of anogenital herpes. It is likely that immune response modifiers similar to imiquimod and resiquimod will find other clinical indications but many questions remain to be answered. Imidazoquinolinamines may have efficacy in the treatment of conditions for which IFN- is currently employed, such as Kaposi's sarcoma (KS) and chronic HCV infection. Cutaneous lesions such as HSV genital ulcers or KS lesions could be treated using the topical preparations already studied. However, conditions such as chronic HCV hepatitis would require an oral formulation and resiquimod may be better suited to these uses. Interestingly, Phase I trials of an oral formulation of imiquimod have already been conducted in HIV-seropositive individuals and patients with cancer^ref. The potential role of oral imiquimod in the therapy of HIV infection is intriguing but caution is warranted; in this trial of oral imiquimod in HIV-seropositive individuals 2 of 10 (20%) individuals demonstrated dramatic increases in plasma HIV RNA copy number, while 2 individuals demonstrated significant decreases. Transcription factors critical for imiquimod-mediated cytokine induction, such as NFkB, also upregulate HIV replication, and the significance of LC migration to lymph nodes in HIV immunopathogenesis needs to be investigated. Imiquimod, and to a greater extent resiquimod, have also demonstrated leishmanicidal activity due to nitric oxide synthesis in macrophages in an animal model of cutaneous leishmaniasis, suggesting other potential uses of imidazoquinolinamines against infection.30 In addition to the therapy of established infection the imidazoquinolines may have activity in therapy of cancers such as basal cell carcinoma (BCC). Of 24 patients treated, at various dosing intervals, with topical 5% imiquimod cream, 20 (83%) lacked evidence of BCC on biopsy 6 weeks after therapy compared with only one of 11 (9%) of the group treated with vehicle control^ref. It remains to be established whether oral formulations of imidazoquinolines will extend the range of potential cancers that could be treated. Furthermore, the role of imidazoquinolines as vaccine adjuvants requires investigation. Adjuvants are essential to enhance the efficacy of vaccination with weak immunogens. The development of safe and effective adjuvants to boost cell-mediated immunity is a priority of human vaccine research. Imidazoquinolines induce T_h1-mediated immune responses as opposed to the T_h2 responses associated with the use of alum, which is currently used as an adjuvant in human vaccines^ref. This is the result of IFN-a and IL-12 production, which enhances IFN-g production. The potential advantages of inducing T_h1 responses in response to immunization could have far-reaching consequences in the management of infections and cancer. Many more studies are urgently needed to determine the safety and applicability of these novel immunomodulating agents in the therapy of HIV infection, other infectious diseases, cancer and in the development of immunization protocols. However, they are already demonstrating clinical utility in the therapy of genital warts, molluscum contagiosum and, potentially, herpes genitalis. In vivo studies have confirmed the induction of IFN-a and TNF-a, as well as other cytokines such as IL-12 p40, in humans and animals treated with topical imiquimod cream or resiquimod gel^{ref1, ref2}.
Immune response modifiers (IRMs) with a TLR-8 agonist component (3M-002 and 3M-003) stimulated greater levels of K562 cytolysis than achieved with 3M-001 or IL-2 (1000 U/ml). In vivo NK-cell cytotoxicity was also enhanced by R-848, but not in type I IFNR-deficient mice^ref.
• masked oral prodrugs of TLR7 agonists, such as ANA-975^ref
• TLR8 agonists :
• 3M-002 and 3M-003^ref
• TLR9 agonists : immunostimulatory (ISS) oligodeoxynucleotides (ODN) => T_h1-polarized immune response. They display their adjuvant effect on the humoral immune response by enhancing terminal differentiation of B cells into plasma cells, but not by increasing memory B cell generation. CpG oligodeoxynucleotides :

ODN type	example	structural characteristics	immunomodulatory activity
D-type CpG ODN (also known as CpG-A)	GGTGCATCGATGCAGGGGGG	mixed phosphodiester (italics)/phosphorothioate backbone single CpG motif (blue)  CpG flanking region forms a palindrome (red)  poly-G tail at 3' end (green)	APC maturation, mediated by IFN-a preferentially stimulates pDCs to secrete IFN-a, which promotes memory-cell proliferation but have anti-proliferative effect on naive T-cells; marked increase in the frequency of IFN-g-producing CD8+ T cells after stimulation with an influenza peptide (memory CD8+ T cells) but not Melan-A peptide (naive CD8+ T cells) (stronger upregulation of CD56 and increase in lytic activity associated with an increase in intracellular levels of granzyme B, compared with CpG-B)ref
K-type CpG ODN (also known as CpG-B)	TCCATGGACGTTCCTGAGCGTT	phosphorothioate backbone multiple CpG motifs (blue)  5' motif most stimulatory	pDC maturation and production of TNF-a(but not IFN-a)  triggers B-cell proliferation and IgM and IL-6 production; most efficient at priming naive T cells to produce CTLs; marked increase in the frequency of IFN-g-producing CD8+ T cells after stimulation with either an influenza peptide (memory CD8+ T cells) or a Melan-A peptide (naive CD8+ T cells)ref
C-type CpG ODN	TCGTCGTTCGAACGACGTTGAT	phosphorothioate backbone  multiple CpG motifs (blue)  TCG dimer at 5' end (purple)  CpG motif imbedded in a central palindrome	stimulates B cells to produce IgM and IL-6 activates pDCs to secrete IFN-a

In CD4⁺ T cells CpG DNA directly enhances proliferation, prevents anergy, and augments humoral responses to a T cell-dependent antigen by a MyD88 and PI-3K-dependent pathway^ref
CpG oligodeoxynucleotides as immune adjuvants :

ODN type		antigenic target	species	route	key response	protection
toxins	K	Clostriudium tetani toxoid	mouse	systemic, oral	IgG	yesref
	K	Corynebacterium diphteriae toxin	mouse	systemic	IgG	yesref
viruses	K	measles virus	neonatal mice	systemic	IgG2a, Th1	N.D.ref
	K	HBV	mouse	intranasal	IgG, IgA	N.D.ref1, ref2
	K	HHV-5 / CMV	mouse	systemic	IgG	N.D.ref
	K	influenzaviruses	mouse	mucosal	IgG	N.D.ref
bacteria	K	Brucella melitensis biovar abortus 544	mouse	systemic	IgG, IFN-g	yesref
	K	Bacillus anthracis	mouse, monkey	systemic	IgG	yes
	K	Mycobacterium tuberculosis	guinea pig	systemic	IgG, DTH	N.D.ref
parasites	K	Plasmodium chabaudi AS malaria	mouse	systemic	IgG2a, IFN-g	yesref
	K, D	Leishmania major	mouse, monkey	systemic, ID	IFN-g	yesref1, ref2
	K	Trypanosoma cruzi	mouse	systemic	IgG2a	yesref


Safety concerns :

• CpG 7909^ref
• 1018 ISS
In mouse deletion of 1-2 nucleobases in the 3'-flanking sequence to a CpG-motif at certain positions did not affect immunostimulatory activity, while similar deletions in the 5'-flanking sequence increased immunostimulatory activity compared with the parent oligo^ref.
TLR9 shows considerable selectivity for CpG DNA sequences with different preferences in mouse (GACGTT) and human (GTCGTT) species. A nucleobase is absolutely required in C, G, P(3), and P(4) positions of the CpG dinucleotide (P(1)P(2)CGP(3)P(4)) for immunostimulatory activity in mouse. Surprisingly, an abasic nucleoside is permitted at either P(1) or P(2) depending on the neighboring base. It was found that 'GXCGTT' motif has an intermediate immunostimulatory activity between those of 'GACGTT' and 'GTCGTT' in the mouse cells^ref. The frequency of arthritis was similar after intra-articular (i.a.) injections of a prototype CpG ODN or the same with a specific nucleobase deletion 3'-downstream, but was significantly lower (p < 0.02) after i.a. injections of the same containing a specific nucleobase deletion 5'-upstream. In vitro production of the pro-inflammatory cytokine TNF-a was higher in mouse spleen cell cultures exposed to ODN-2 in comparison to a prototype CpG ODN. In addition, the level of IL-10 induced by the same containing a specific nucleobase deletion 5'-upstream was higher than that induced by a prototype CpG ODN. On the other hand, TNF-a, IL-10, and MCP-1 levels, as well as splenocyte proliferative responses were all significantly lower for CpG ODNs containing a specific nucleobase deletion 3'-downstream than for a prototype CpG ODN. These results suggest that a 5'-upstream nucleobase deletion reduces arthritogenicity, while maintaining or increasing the production of pro- and anti-inflammatory factors. In contrast, a 3'-downstream nucleobase deletion has no effect on arthritogenicity, despite significantly lower levels of proliferation and pro- and anti-inflammatory cytokines, compared with a prototype CpG ODN. This study indicates that specific structural elements within the ODN sequence but outside the CpG motif, modulate the immunostimulatory properties of CpG ODNs^ref. The presence of PDCs synergistically enhanced CD86 expression, cytokine production (IL-6, TNF-a, and IL-10) and plasma cell differentiation of isolated human peripheral blood B cells stimulated through CpG-C and BcR ligation. This stimulation protocol was sufficient to drive purified naive B cells into IgM-producing plasma cells and to trigger IgG synthesis in memory B cells. PDCs contributed to B-cell activation via IFN-a secretion. Up-regulation of TLR9 on B cells was not involved. These results demonstrate that CpG-stimulated PDCs induce plasma cell differentiation in naive and memory B cells in the absence of T-cell help, providing an explanation for the excellent activity of CpG oligonucleotides as a humoral vaccine adjuvant^ref. The ability of CpG ODN to activate the immune effector cells that participate in antibody-dependent cellular cytotoxicity (ADCC), upregulate target antigen, and perhaps induce development of an active immune response, suggest these agents may be capable of enhancing the efficacy of antitumor moAb therapy. Such enhanced efficacy has been demonstrated in animal models and is now undergoing evaluation in clinical trials^ref. CpG ODNs can also enhance the efficacy of tumor immunization through use as an immune adjuvant, to activate APCs, or as a component of DNA vaccines^ref. Colon carcinomas were induced in BALB/c mice by s.c. injection of syngeneic C26 cells or Renca kidney cancer cells as a control. Injection of CpG ODN alone or in combination with irradiated tumor cells did not protect mice against subsequent tumor challenge. In contrast, weekly injections of CpG ODN into the margin of already established tumors resulted in regression of tumors and complete cure of mice. The injection site was critical, since injection of CpG ODN at distant sites was not effective. Mice with 2 bilateral C26 tumors rejected both tumors upon peritumoral injection of one tumor, indicating the development of a systemic immune response. The tumor specificity of the immune response was demonstrated in mice bearing a C26 tumor and a Renca tumor at the same time. Mice that rejected a tumor upon peritumoral CpG treatment remained tumor free and were protected against rechallenge with the same tumor cells, but not with the other tumor, demonstrating long term memory. Tumor-specific CD8 T cells as well as innate effector cells contributed to the antitumor activity of treatment. In conclusion, peritumoral CpG ODN monotherapy elicits a strong CD8 T cell response and innate effector mechanisms that seem to act in concert to overcome unresponsiveness of the immune system toward a growing tumor^ref. In CpG ODN-stimulated PDC and B cells, TLR9 expression rapidly decreased, as opposed to TLR7, which was up-regulated in PDC and decreased in B cells. In monocytes, NK cells, and T cells, TLR7 was absent. Despite low expression of TLR9, monocytes, NK cells, and T cells did not respond to CpG ODN in the absence of PDC but were activated in the presence of PDC. PDC and B cells, but not monocytes, NK cells, or T cells, are primary targets of CpG ODN in peripheral blood. The characteristic expression pattern of TLR1-10 in cellular subsets of human PBMC is consistent with the concept that TLR9 is essential in the recognition of CpG ODN in PDC and B cells. In addition, selective regulation of TLR7 expression in PDC and B cells by CpG ODN revealed TLR7 as a candidate TLR potentially involved in modulating the recognition of CpG motifs^ref. Previously, we described CpG ODN that strongly activate human B cells and human blood dendritic cells. Here we describe distinct CpG-containing oligonucleotide sequences which, in contrast to previously described CpG ODN, induced high amounts of IFN-a and IFN-b in peripheral blood mononuclear cells (PBMC). Intracellular staining for IFN-a revealed that within PBMC CpG ODN-induced IFN-a is produced exclusively by PDC. Unlike IFN-a, TNF-a is up-regulated in PDC by all CpG ODN tested. Purified PDC responded to CpG ODN, demonstrating direct activation of PDC by CpG ODN. The most active sequence induced the production of up to 5 pg IFN-a per single PDC, resulting in > 400 ng/ml IFN-a in the supernatant of PBMC enriched for PDC. The potency of CpG ODN to stimulate IFN-a correlated with their ability to stimulate NK cell lytic activity, while purified NK cells did not respond to CpG ODN. IFN-g production in PBMC was dependent on CpG ODN-induced IFN-a/b as demonstrated by IFN-a/b blocking antibodies. IFN-a-inducing CpG ODN strongly supported IFN-g production of TCR-triggered CD4 T cells but were less active than other CpG ODN in stimulating B cells. In conclusion our results demonstrate that particular CpG ODN sequences exist which, due to high IFN-a/b induction in PDC, induce a set of immune responses typical for viral infection^ref. CpG oligodeoxynucleotide (CpG ODN 2006), but not control (non-CpG ODN), increased the expression of costimulatory molecules (CD40, CD80, CD86, CD54) on malignant B cells without altering the phenotype of B cells obtained from reactive follicular hyperplasia. CpG ODN also enhanced expression of class I and class II MHC in most samples. CD20 expression was increased in response to CpG ODN, most notably in B-CLL and MZL. An inverse correlation was found between baseline expression of CD20 and CD40 and their expression after exposure to CpG ODN, thus the most significant increase in expression of these molecules was found in those samples that had the lowest baseline levels. In conclusion, CpG ODN can lead to increasing expression of molecules involved in costimulation, antigen presentation, and as targets for antibody-based therapy and deserve further evaluation as potential immunotherapeutic agents for B cell malignancy^ref.
Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG ODNs and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Plasmacytoid DCs (pDCs) are required for CpG ODN-mediated protection against lethal vaginal challenge with HSV-2. Moreover, cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-a/b receptor for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses^ref.
Myeloid and plasmacytoid DCs in the spleen express TLR9, but lung DCs show no detectable expression in either subset. TLR4 expression in contrast was detected on both lung and spleen DCs. LPS was superior to CpG ODN in increasing the allostimulatory potential of lung DCs and their expression of CD40. However, both agonists efficiently stimulated spleen DCs. CpG ODNs administered to mice efficiently inhibited T_h2 cytokine production both in the lung draining lymph node and in the spleen. Surprisingly, inhibition of T_h2 cytokine production was evident despite high levels of expression of GATA-3 and additional transcription factors that regulate T_h2 responses. Although in the spleen CpG ODNs induced IL-6, a key cytokine induced via TLR9-MyD88 signaling, no IL-6 was detectable in lung LN cells. These studies show for the first time that lung DCs lack TLR9 expression, but, despite this deficiency, CpG ODNs induce potent inhibitory effects on T_h2 cytokine production in the lung without inducing expression of the proinflammatory cytokine, IL-6, which has been linked to chronic diseases in the lung and the gut^ref.
In a single institution phase I / II trial, patients with refractory low-grade B-cell lymphoma of any initial stage or mycosis fungoides of stage IB-IVA will receive low-dose radiotherapy to a single tumor site on days 1 and 2 (2 Gy each day). CpG (CPG 7909) injections (4 intratumoral injections followed by 6 peri-tumoral injections) will be administered into the same tumor site within the 24 hours before and the 24 hours after the radiation, and on days 8 and 15. Weekly doses of CpG will be then administered subcutaneously in the region of previous injections for 6 additional doses.
Oligodeoxynucleotides containing CpG motifs (CpG ODN) can alter various immune cell subsets important in antibody therapy of malignancy. A phase I trial of CPG 7909 (also known as PF-3512676) in patients with previously treated lymphoma with the primary objective of evaluating safety across a range of doses, and secondary objectives of evaluating immunomodulatory effects and clinical effects. 23 patients with previously treated non-Hodgkin lymphoma received up to 3 weekly 2-hour intravenous (IV) infusions of CPG ODN 7909 at dose levels 0.01 to 0.64 mg/kg. Evaluation of immunologic parameters and clinical endpoints occurred for 6 weeks. Infusion-related toxicity included grade 1 nausea, hypotension, and IV catheter discomfort. Serious adverse hematologic events observed more than once included anemia (2=Gr3, 2=Gr4), thrombocytopenia (4=Gr3), and neutropenia (2=Gr3), and were largely judged owing to progressive disease. Immunologic observations included: (1) The mean ratio of NK-cell concentrations compared with pretreatment at day 2 was 1.44 (95% CI=0.94-1.94) and at day 42 was 1.53 (95% CI=1.14-1.91); (2) NK activity generally increased in subjects; and (3) ADCC activity increased in select cohorts. No clinical responses were documented radiographically at day 42. 2 subjects demonstrated late response. CpG 7909 can be safely given as a 2-hour IV infusion to patients with previously treated NHL at doses that have immunomodulatory effects^ref.
In a randomized, double-blind, placebo-controlled phase 2 trial of a vaccine consisting of Amb a 1, a ragweed-pollen antigen, conjugated to a phosphorothioate oligodeoxyribonucleotide immunostimulatory sequence of DNA (AIC) in 25 adults who were allergic to ragweed. Patients received six weekly injections of the AIC or placebo vaccine before the first ragweed season and were monitored during the next 2 ragweed seasons. The regimen of the AIC vaccine appeared to offer long-term clinical efficacy in the treatment of ragweed allergic rhinitis^ref. In a randomized, blinded, phase 1 study involving 19 patients with ragweed allergy, we measured ragweed-specific recall responses in antigen-stimulated primary cultures before and 2 and 16 weeks after 6 subcutaneous injections of either an Amb a 1 immunostimulatory DNA vaccine or placebo. In vivo ragweed-specific responses by T_h2 cells were selectively redirected toward balanced responses in parallel with increased activity by T_h1 cells. There were significant decreases in levels of IL-5, CCL17 and CCL22 at 2 and 16 weeks in vaccine-treated patients, accompanied by transient increases in levels of IFN-g, CXCL9 and CXCL10, respectively). Unrelated (streptokinase) responses and global (phytohemagglutinin) responses were not altered^{ref1, ref2}.
• SHP-1 inhibitors
• retinoic acid derivatives induce the expression of proteolytic and regulatory subunits of the immunoproteasome, increase the half-life of MHC class I complexes, and enhance the sensitivity of neuroblastoma cells to both MHC class I-restricted peptide-specific and HLA nonrestricted lysis by CTLs. Importantly, effects of retinoids on the MHC class I pathway appear to be independent of IFN-g and/or TNF-a as intermediate messengers. To our knowledge, this is the first demonstration of inflammation-unrelated biological molecules that induce systemic modulation of antigen presentation in nonprofessional antigen presenting cells^ref
• immunostimulating phytotherapeuticals
• Astragalus membranaceus
• Ligustrum lucidum
• Viscum albus (European mistletoe) : viscotoxins (VT) and mistletoe lectins (ML) / viscumins / Viscum album agglutinins increase natural killer (NK) cell-mediated killing of tumor cells by acting on cell conjugates to increase the resulting lysis but spare nontarget cells from NK lysis^ref, induce apoptosis in lymphocytes and tumor cells via IL-4^ref and activate granulocytes^ref
• quinovic acid (Cinchonoideae : Uncaria tomentosa)
• cichoric acid (Echinacea spp.)^{ref1, ref2}



• phytosterols (PS) / sterolins : because they are bound to the fibers of the plant and actively expulsed from cells by ABCG5 / sterolin-1 or ABCG8 / sterolin-2, they are difficult to absorb during the transit of digested food through the gut, particularly in individuals with impaired digestive function. For this reason, and because much of the modern diet is over-processed and low in fresh plant materials, sterols and sterolins appear in the serum and tissue of healthy humans at 800-1000 times lower concentrations than that of cholesterol.
• b-sitosterol (BSS) is the major phytosterol in higher plants along with its glycoside, b-sitosterolin (BSSG). Animal studies have demonstrated BSS and BSSG possess anti-inflammatory, antipyretic, antineoplastic, and immune-modulating properties. In other in vitro, animal, and human studies, a proprietary BSS:BSSG mixture has shown promise in shifting immune responses from a T_h2 to a T_h1 polarization, dampening overactive antibody responses, and normalizing DHEA:cortisol ratios. Research has shown plant oils contain the highest concentration of phytosterols, nuts and seeds contain moderate amounts, and fruits and vegetables generally contain the lowest phytosterol concentrations.


• fucoidan
• some adjuvants
• glucosylceramide synthase inhibitors : multiple factors influence the formation, progression, and metastasis of tumors in vivo. It is increasingly recognized that tumor-derived molecules may play an important role in enhancing tumor formation either by acting directly on the tumor cell or on the host. In these ways, tumor-derived factors may alter the tumor microenvironment in such a manner as to enhance tumor cell survival or modify the host responses to the tumor. One class of tumor-derived molecules that has received recent attention is the tumor-derived gangliosides^ref. These sialic acid-containing glycosphingolipids, which are components of the outer leaflet of the cell membrane, are actively shed by tumor cells^{ref1, ref2, ref3, ref4} and taken up by the host cells in the tumor microenvironment^ref. The biological properties and actions of tumor gangliosides have now been well documented. These include potent immunosuppressive activity^{ref1, ref2, ref3, ref4}, proangiogenic properties^{ref1, ref2, ref3}, and, more recently, enhancement of growth factor-mediated fibroblast and vascular endothelial cell proliferation^{ref1, ref2, ref3}. Increased expression of gangliosides has been associated with enhanced tumor formation^ref, and a correlation has been established between the expression and/or shedding of certain gangliosides and accelerated tumor progression in human tumors, such as neuroblastoma^ref. These combined findings implicating tumor gangliosides as having important roles in tumor formation and progression have led to our hypothesis that reduced ganglioside synthesis and shedding could result in decreased tumor incidence, impeded tumor progression, and/or decreased metastasis. This was documented in vivo in an experimental system in an indirect manner, by demonstrating that the addition of purified tumor gangliosides enhanced the tumorigenicity of a poorly tumorigenic, ganglioside-deficient murine lymphoma cell line^ref. Adding further support to this concept, pharmacologically induced cellular ganglioside deficiency resulted in a reduction of melanoma^ref and brain tumor^ref formation in mice. Transfection of an antisense sequence to glucosylceramide synthase, the enzyme catalyzing the initial step in the synthesis of all glucosylceramide-based glycosphingolipids, inhibits tumor formation in syngeneic murine orthotopic MEB4 melanoma^ref. These data demonstrate high ganglioside expression in tumors, a biological role of gangliosides, and the possibility of inhibition of expression by certain strategies. This suggests that a practical strategy for pharmacologic induction of cellular ganglioside deficiency could be a promising and novel therapeutic approach to human cancer. This possibility was systematically evaluated in the above orthotopic model of murine melanoma^ref. We studied a novel inhibitor of glucosylceramide synthase that can be administered systemically, the imino sugar OGT2378, a molecule related to NB-DNJ3 (OGT918), which has been shown to be effective in the treatment of type 1 Gaucher’s disease^ref. Both a potent inhibitory effect on glycosphingolipid synthesis in the MEB4 melanoma cell line, without antiproliferative or cytotoxic effects in vitro, and marked inhibition of melanoma tumor growth in vivo after p.o. administration of OGT2378 were demonstrated. The rationale for using inhibitors of glycosphingolipid synthesis as a therapeutic approach to tumors derives from substantial data supporting a role for gangliosides in the process of tumor formation. From the initial description of tumor cell ganglioside shedding and immunosuppressive activity^ref, to the correlation and direct evidence for a role in tumor formation in mice^ref, and a link with tumor progression in humans^ref, the accumulated findings of many laboratories have now established a biological role for gangliosides in a number of tumor systems^ref. The possibility that inhibition of ganglioside synthesis by tumor cells may decrease tumor cell ganglioside content and impede tumor progression has been of recent interest^ref. In vitro studies have shown that the inhibition of ganglioside synthesis, e.g., by inhibitors of glucosylceramide synthase, results in decreased ganglioside shedding^ref, which in turn has been associated with a reduced inhibitory effect on the host immune response and reduced enhancement of normal growth factor-induced endothelial cell and fibroblast proliferation^{ref1, ref2}. Treatment of tumor cells in vitro with two inhibitors of glucosylceramide synthase, D-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol and PPPP, has resulted in decreased ganglioside content and decreased tumor formation^{ref1, ref2, ref3}. However, PPPP is highly toxic and cannot be administered in vivo. Recently, glucosylceramide synthase antisense clones, which have decreased ganglioside content but only marginally increased ceramide and no significant increase in apoptosis^ref, have also shown inhibited tumor formation, compared with untransfected or sense-transfected control cells. Together, these studies have suggested that this inhibition of tumor cell ganglioside expression may be a viable approach to cancer treatment. Whether systemic treatment with an inhibitor of glucosylceramide synthase would be feasible in this context has not been well studied; there is one report that NB-DNJ reduced tumor cell proliferation in vitro and tumor formation in vivo in a murine brain tumor^ref. On the other hand, there has already been substantial interest in the use of inhibitors of glucosylceramide synthase to treat glycolipid storage diseases by substrate reduction (e.g., Gaucher’s disease^ref), and NB-DNJ has been used with success in this manner in humans^ref. Thus, inhibition of glycosphingolipid synthesis has been identified as a therapeutic target in glycolipid storage disease. Administration of a new imino sugar, OGT2378, caused highly effective depletion of gangliosides in vivo and particularly of tumor tissue gangliosides. A relevant tumor system, namely an orthotopic model of melanoma, generated by intradermal injection of MEB4 melanoma cells, was used  to study its effect on tumor formation^{ref1, ref2}. In this syngeneic tumor model, the continuous p.o. administration of OGT2378, in the diet, was well tolerated and resulted in highly significant inhibition of tumor growth, even when treatment was initiated only after establishment of the tumor. In addition, the fact that in the present study we found no inhibition of tumor cell proliferation in vitro is of importance because it reduces the likelihood of side effects in vivo caused by a direct cytotoxic or antiproliferative effect of the drug. These findings underscore the potential significance of ganglioside metabolism as a new therapeutic target and suggest promise for OGT2378 as an example of a potentially very effective new approach to interfering with tumor progression^ref
• the high-sulfate-containing exopolysaccharide p-KG03 is produced by the red-tide microalga Gyrodinium impudicum strain KG03. The immunostimulatory effects of this sulfated exopolysaccharide were investigated by isolating peritoneal macrophages from mice 10 or 20 days after they had received a single dose of p-KG03 (100 or 200 mg/kg body weight). The cytotoxicity of the isolated macrophages for B16 tumor cells was tested, as B16 tumor cells are sensitive to TNF-a and nitric oxide. The activities of NK cells from the p-KG03-treated mice against YAC-1 mouse lymphoma cells were also tested. The nonspecific immune functions mediated by NK cells and macrophages were increased by treatment with p-KG03 in vivo. These results suggest that p-KG03 has immunostimulatory effects and enhances the tumoricidal activities of macrophages and NK cells in vivo. In addition, p-KG03 treatment increased the plaque-forming cell response to sheep red blood cells, as well as the levels of IgM and IgG Exposure to p-KG03 also increased the production by macrophages of cytokines, such as IL -1b and -6, and TNF-a. This is the first report of a marine microalgal sulfated polysaccharide having immunostimulatory activities. The p-KG03 polysaccharide may be useful for the development of biotechnological and pharmaceutical products that incorporate bioactive marine exopolysaccharides^ref.
• contact sensitizers :
• dinitrochlorobenzene (DNCB)
• diphenylcyclopropenone (DPCP)
• squaric acid dibutylester (SADBE)
Used for the treatment of warts, alopecia areata, and even skin cancers. Most of these studies have utilized these powerful topical immunomodulators in acetone, a volatile solvent that precludes development of contact sensitizers as products. These problems have been overcome and stabilized these topical immunomodulators in a non-volatile, nonirritating GRAS (generally regarded as safe) vehicle. The current review article covers the traditional use of contact sensitizers for a variety of benign and malignant conditions and discusses possible mechanisms in relation to developments in modem molecular immunodermatology^ref.
• protein-bound polysaccharide K (PSK) increased the 5-year disease-free survival rate and reduced the risk of recurrence in a randomised, controlled study for stage II and III colorectal cancer. In order to elucidate the disease-free survival benefits with PSK and what immunological markers could indicate a PSK responder, serial changes in immunological parameters were monitored in the study. PSK decreased the mean serum immunosuppressive acidic protein (IAP) level, and increased the mean population of natural killer (NK) cells compared with the controls. The 5-year disease-free and overall survival rate for patients with serum IAP values <or=500 microg ml(-1), which represents the normal value, were 75.5% (95% CI: 66.8-84.2%; p=0.016) and 85.1% (95% CI: 77.9-92.3%; p=0.032), respectively, in the PSK group compared with 57.5% (95% CI: 43.3-71.6%) and 70.2% (95% CI: 57.1-83.3%) in the control group. In patients with NK cell population >or=8% at 3 months after surgery, PSK conferred a significantly better (p=0.038) 5-year disease-free survival (86.7%; 95% CI: 74.5-98.8%) compared to the control group (60.0%; 95% CI: 29.6-90.4%). In the proportional hazards model, the presence of regional metastases (relative risk, 3.595; 95% CI: 1.518 to 8.518; p=0.004) and omission of PSK treatment (relative risk, 3.099; 95% CI: 1.202 to 7.990; p=0.019) were significant indicators of recurrence. PSK acts as an immunomodulatory activity and biochemical modulator in stage II or III colorectal cancer. Pre-operative serum IAP values <or=500 microg ml(-1) and an NK cell population >or=8% at 3 months after surgery are possible PSK response predictors^ref.

• gold salts (aurotherapy / chrysotherapy)
• aurothioglucose (Solganal^®)
• gold sodium thiomalate : IM, inhibits lymphocyte proliferation, exocytosis, ROS formation, and neutrophil chemotaxis
• auranofin / S-triethylphosphinegold(I)-2,3,4,6-tetra-O-acetyl-1-thio-b-D-glucopyranoside (Ridaura^®) : PO, peak after 2-6 hours, binds to plasma protein, specifically interacts with thiol and/or selenol groups (in the presence of calcium ions, is a highly efficient inducer of mitochondrial membrane permeability transition, potentially referable to its inhibition of mitochondrial thioredoxin reductase), urine excretion, accumulation in tissues; therapy usually last for 2-7 years.
Side effect : chrysiasis
• mesalamine / 5-aminosalicylic acid (5-ASA) and derivatives :
• non-sulfonamide-containing formulations
• mesalamine / 5-aminosalicylic acid (5-ASA)
• olsalazine
• balsalazide (Colazide^®, Colazal^®) : mesalamine linked to an inert carrier (4-amino-benzoyl-b-alanine)
• sulfonamide-containing formulations
• sulfasalazine / salicylazosulfapyridine / salazoprine (Azaline^®, Azulfidine^®, Salazopyrin^®) : linked to sulfapyridine by a diazo bond which is split by bacterial azoreductases in the colon. Used in IBDs, PO, inihibits COX-2 and LOX pathways and acts as a ROS scavenger.
Side effects : headache, gastrointestinal disorders. As most sulfonamides, it may cause anaphylaxis, hematic dyscrasia (including hemolytic anemia in G6PD deficitary individuals), drug rash with eosinophilia and systemic symptoms (DRESS)
• antimalarial drugs
• chloroquine
• hydroxychloroquine

Side effects : retinopathy
• thiol donors
• D-penicillamine / D-dimethylcysteine (Cuprimine^®, Depen^®) (a catabolyte from penicillin hydrolysis). PO, peak within 1-2 hrs, 80% bound to plasma proteins, renal excretion. It inhibits IL-1 synthesis by macrophages and fastens collagen maturation in cartilage.

Side effects : fever, stomatitis, anorexia, ageusia, nausea and vomiting, cough, glomerulonephritis with nephrotic syndrome, drug-induced pemphigus (5%), autoimmune thyroid diseases, myasthenia gravis, aplastic anemia, leukopenia, thrombocytopenia, drug rash with eosinophilia and systemic symptoms (DRESS).
• bucillamine (Rimatil^®), a cysteine derivative that contains two donatable thiol groups, is capable of replenishing the thiol group in glutathione, thereby reactivating this endogenous defense against oxidant injury. Bucillamine rapidly enters cells by the same mechanism that normally transports the amino acid cysteine. Bucillamine is a more potent thiol donor than other cysteine derivatives: approximately 16-fold more potent than N-acetylcysteine in vivo. In addition bucillamine appears to have additional anti-inflammatory effects unrelated to its antioxidant effect. Oral bucillamine is used clinically in Asia for treatment of rheumatoid arthritis. There is a strong preclinical evidence that parenteral infusion of this agent is efficacious in acute settings characterized by inflammation and oxidative stress. In an investigator-blinded, rigorous intact dog model, consisting of 90 min of coronary artery occlusion and 48 h of reperfusion, bucillamine, given i.v. during the first 3 h of reperfusion, substantially reduced myocardial infarct size. Livers exposed to 24 h of cold ischemia were markedly protected by bucillamine in several transplantation models. In Phase I human studies in normal volunteers, bucillamine at doses up to 25 mg/kg/h i.v. for 3 h elicited no serious toxicity. On the basis of pharmacokinetic analyses of blood levels during these studies it was concluded that bucillamine, infused at i.v. doses > or =10 mg/kg/h for 3 h to humans could be expected to be therapeutically effective in myocardial infarction, organ transplantation and other acute inflammatory syndromes.
• N-acetylcysteine (Mucomyst^®)
• COX-2 selective inhibitors (CSI) : generally prohibit taking the pills for > 10 days in a row. Many of the diseases helped by fish oils (from asthma to heart disease) have one thing in common: chronic inflammation, in which immune cells and molecular mediators flood tissues and can create damage. This can lead, for example, to the arteriosclerosis that spurs heart attacks and strokes. In a 1999 study subjects had consumed 1 g of fish oil each day and were protected from cardiovascular diseases, but that almost all of the subjects were also taking aspirin to prevent strokes and heart attacks. Aspirin speeds up the conversion of w-3 fatty acids (essential fatty acid eicosapentaenoic acid (EPA)) in the fish oil into lipids that seem to suppress inflammation. First they found that healthy human volunteers fed both aspirin and fish oil had resolvin E1 (RvE1) / 5S,12R,18R-trihydroxy-6Z,8E,10E,14Z,16E-EPA in their bloodstream. A synthetic form of the lipid inhibits the migration of human dendritic cells, dramatically reduced inflammation on the skin of rabbits and works in a mouse model of periodontal gum disease^ref.
• NO-NSAIDs : as with prostaglandins, nitric oxide (NO) protects the gastric mucosa. Indeed, enhancement of NO-dependent protection during development may explain why COX-1 knock-out mice do not develop gastric ulcers^ref and provide a model of protective mechanism substitution that could be used clinically. NO-NSAIDs, currently in human testing (e.g. flurbiprofen / HCT 1026^ref), have a NO moiety linked to a conventional NSAID^ref. In theory they donate NO to the gastric mucosa to counterbalance the harmful effects of prostaglandin deficiency. Studies in animals show a good gastrointestinal safety profile. NO-NSAIDs could challenge COX-2 inhibitors because the benefits of COX-1 inhibition can be retained. They appear not to retard, or even to enhance, healing of established ulcers in animal studies^ref. Moreover, NO-aspirin, unlike COX-2 inhibitors, has potential as a safer agent for cardiovascular prophylaxis. This would be important because, ironically, aspirin is rapidly becoming a more important cause of ulcer bleeding than non-aspirin NSAIDs (Stack WA, Hawkey GM, Atherton JC, et al. NSAIDs and CagA positive H pylori but not CagA negative H pylori as independent risk factors for bleeding peptic ulcers. Gastroenterology 1998; 114: A294). However, there are fewer data on NO-NSAIDs than COX-2 inhibitors and it is too soon to tell whether these drugs will offer practical advantages and if so in which areas.

	flogosis	fever	pain	usual antiinflammatory dose
aspirin	++	++	++
indomethacin	++		++
naproxen			+	250-500 mg, twice daily
fenoprofen				300-600 mg, 3-4 times a day
ibuprofen			++	400-800 mg, 3-4 times a day
ketoprofen				50-75 mg, 3-4 times a day
flurbiprofen				50-75 mg, 2-4 times a day
oxaprozin				600-1200 mg, once daily
diclofenac	++		++
ketorolac	+		++
piroxicam	++		++
meloxicam	++		++
phenylbutazone		+++ (no longer used)
nimesulide	+		+ (reduces diuresis)
acetaminophen	++	++	+ (fulminating hepatitis)
tramadol			++

Indications : cancer chemoprevention
Side effects :
• from inhibition of COX-2 : nephropathies (reversible acute renal failure, papillary necrosis, acute interstitial nephritis, hyperazotemia, ARF, nephrosic syndrome) => systemic arterial hypertension ?. A higher relative risk of thrombotic cardiovascular complications has recently emerged in studies evaluating the use of NSAIDs such as rofecoxib, celecoxib, and naproxen. Direct pro-thrombotic effects of selective COX-2 inhibition were originally speculated to be the potential mechanism behind these results, but this proposal fails to explain the pro-thrombotic effects of non-selective NSAIDs. The paradoxical pro-inflammatory, pro-thrombotic effects associated with chronic use of anti-inflammatory agents might be attributable to compensatory host response rather than direct effects of the drugs. Chronic pharmacologic inhibition of inflammation may induce physiologic dependence, and cessation of therapy has been shown to produce rebound effects in aspirin, statins, and other immunomodulatory agents. By down-regulating inflammatory pathways in a pulsatile fashion, chronic use of NSAIDs may promote compensatory up-regulation of these same pathways and shift the host baseline equilibrium towards an inflammatory state. The host may be susceptible to inflammation between intermittent doses and after withdrawal of therapy. Inflammation is a promoter of adrenergia and thrombosis, and the constellation of these effects may predispose to excess risk of acute cardiovascular events^ref.
• rofecoxib
• patients with rheumatoid arthritis and osteoarthritis experienced significantly higher risks of oedema and systemic arterial hypertension than did those using celecoxib^ref
• withdrawn in Sep 2004 due to increased risk of stroke and heart attack. Vioxx was yanked from the market after dramatic testimony by whistle-blower David Graham, who claimed that CDER officials had tried to prevent him from disseminating information about the danger of the drug. An increased risk of myocardial infarction had been observed in 2000 in the Vioxx Gastrointestinal Outcomes Research study (VIGOR), but was attributed to cardioprotection of naproxen rather than a cardiotoxic effect of rofecoxib. By the end of 2000 (52 myocardial infarctions, 20742 patients) the relative risk from randomised controlled trials was 2.30 (95% CI 1.22-4.33, p=0.010), and 1 year later (64 events, 21432 patients) it was 2.24 (1.24-4.02, p=0.007). There was little evidence that the relative risk differed depending on the control group (placebo, non-naproxen NSAID, or naproxen; p=0·41) or trial duration (p=0·82). In observational studies, the cardioprotective effect of naproxen was small (combined estimate 0·86 [95% CI 0.75-0.99]) and could not have explained the findings of the VIGOR trial. Rofecoxib should have been withdrawn several years earlier. The reasons why manufacturer and drug licensing authorities did not continuously monitor and summarise the accumulating evidence need to be clarified^ref. 27,785 heart attacks between 1999 and 2003 have been attributed to Vioxx use. 2.5 billions of US$ were revenue from Vioxx sales in 2003. 28 billions of US$ were lost in shareholder value after Vioxx was pulled from the market. Among 1.4 million Californians who had used anti-inflammatory drugs, users of Vioxx were between 1.6 and 3.6 times more likely to experience heart trouble than users of celecoxib. By combining data from Merck's clinical trials with data on how many patients took Vioxx, the group concluded that the drug had caused between 88,000 and 140,000 cases of coronary heart disease or heart attacks in the USA before it was withdrawn from sale^ref. Almost 66% of new prescriptions written between 1999 and 2002 went to patients who were not at risk of internal bleeding. By 2002 only 39% of patients receiving the class of drugs that includes Vioxx actually needed that type, rather than earlier types of painkiller^ref
• celecoxib :
• on Dec 2004 the NCI suspended a trial studying whether celecoxib might help prevent colorectal cancer. An advisory panel had pointed out that participants on celecoxib had a 2.5-fold increased risk of major heart problems compared with those taking a placebo^ref
• it was hoping to show that a daily dose of painkiller (either celecoxib or naxopren) could ward off the mental degeneration caused by Alzheimer's disease (AD), but was suspended after the recall of rofecoxib. However, this trial data show no increased heart risk for participants taking celecoxib, even after 3 years, but there was a roughly 50% increase in risk of heart problems for those taking the naproxen, which belongs to a class of painkiller that is sold over the counter and to which ibuprofen also belongs. There are no trials of the long-term use of this type of painkiller, but Breitner's independent safety panel decided on 10 Dec that the naproxen risks were minor. It recommended that the study continue and it was actually the fears of the participants that made Beringer decide to pull the plug^ref.
• from concentrations effective also on COX-1 : nausea, vomiting, peptic gastric ulcer (inhibition of PGE₂ synthesis => decrease of mucus secretion) => gastro-intestinal hemorrhages (expecially from celecoxib), exanthemas, hemorrhages (inhibition of TxA₂ synthesis), rarely hepatopathies
• pseudoallergic reactions : urticaria, pruritus, bullous dermatitis
• agranulocytosis
• headache, vertigo, mental confusion, convulsions, visual disturbance
• jaundice
• diarrhea
• potentiation of oral antidiabetics, antiplatelet drugs, anticoagulants
• Reye's syndrome
CSIs are associated with a moderate increase in the risk of vascular events, as are high dose regimens of the traditional non-steroidal anti-inflammatory drugs (NSAIDs) ibuprofen and diclofenac, but high dose naproxen is not associated with such an excess^ref
Web resources : NSAIDs and COX-2 inhibitors
• NFkB or IKK-b inhibitors prevent multiple organ dysfunction syndrome (MODS) that is normally triggered by gut ischemia-reperfusion but also result in severe apoptotic damage to the reperfused intestinal mucosa. These results show the dual function of the NF-kB system, which is responsible for both tissue protection and systemic inflammation, and underscore the caution that should be exerted in using NF-kB and IKK inhibitors.
• H₁ antagonists
• H₂ antagonists
• B₁ antagonists
• PAFR antagonists
• cys-LT1 antagonists
• proteases
• seaprose S / promelase (Altan^®, Flaminase^®)
• bromeline (Ananase^®)
• 
  
• AD 452 (source : Arakis Ltd.)

• Immunopharmacology Research Group @ East Tennessee State University
• Immunopharmacology On-Line Reference
• Immunopharmacology @ University of Liverpool

Copyright © 2001-2014 Daniele Focosi. All rights reserved | Terms of use | Legal notices
 About this site  | Acknowledgements  |    |    | Current link partners
Abbreviations and acronyms  |  Medical terminology  |  Add a link  |   | Softwares |  Cite this page!

---